Disclosure of Invention
The invention provides a preparation method of a recombinant rescue virus of XI type newcastle disease virus (F48E 9), the recombinant virus and application thereof, wherein a reverse genetic operation system of the XI type newcastle disease virus F48E9 strain is established, a P gene in a full-length genome in the reverse genetic system is subjected to site-directed amino acid mutation, and full-length NDV genome cDNA thereof is rescued, so that XI type newcastle disease virus P protein mutant strains rF48E9/P (R386A) and rF48E9/P (K387A) are rescued, the virulence of the two recombinant viruses is obviously weakened, and meanwhile, the recombinant virus has high titer and stable genetic performance on chick embryos, has no pathogenic ability on animals, provides technical support for development of new generation newcastle disease vaccines, and solves the problems in the prior art.
One of the technical schemes adopted by the invention is as follows:
a preparation method of a recombinant rescue virus of XI type newcastle disease virus (F48E 9) comprises the following operation steps:
(1) Construction of full-length cDNA transcription vector of genome of type XI Newcastle disease virus (F48E 9):
Full-length cDNA of the XI type NDV F48E9 strain genome is constructed in a plasmid pBR322, and the plasmid is named pBR322-rF48E9;
(2) Establishment of reverse genetics system of XI type newcastle disease virus:
Designing primers required by constructing a carrier for mutating different amino acid sites of P protein into alanine (A) according to the sequence of a full-length infectious cloning carrier pBR322-rF48E9 of an XI type NDV F48E9 strain, wherein the construction of the carrier is to amplify a point mutation fragment by using an overlap method, then connect the amplified fragment with the carrier by using a homologous recombination method, namely adding 15-20bp bases homologous to the tail ends of the carrier after enzyme digestion on the upstream and downstream of the primers, and the constructed plasmid is named pBR322-rF48E9/P (A);
(3) Preparation of recombinant virus of P protein amino acid point mutation of XI type newcastle disease virus:
Plasmids pBR322-rF48E9, pBR322-rF48E9/P (A) were co-transfected with pCI-NP, pCI-P, and PCI-L, pCAGGS-T7, respectively, BHK-21 cells (hamster kidney cells), cell supernatants were collected 3-4 days after transfection and inoculated into allantoic cavities of 9-11 day old SPF chick embryos, 3 samples were inoculated per sample, 0.2 mL/piece, and recombinant virus rF48E9/P (A) and control virus rF48E9 were successfully harvested.
Further, the mutation points of different amino acids in the step (2) are 386 R or 387 K, and the recombinant virus rF48E9/P (R386A) or the recombinant virus rF48E9/P (K387A) is obtained through the step (3).
Further, the construction method of the cDNA transcription vector in the step (1) comprises the following operation steps:
(1) Removing the fragment between the AscI and Rsr II sites of plasmid pBR322 and replacing with 122nt oligonucleotide linker, inserting 84nt delta hepatitis virus (HDV) anti-genome ribozyme sequence and T7RNA polymerase transcription termination signal into the downstream end of the linker;
(2) Extracting RNA from allantoic fluid of chicken embryo infected by NDVF48E9, generating full-length cDNA of complete 15192nt genome by RT-PCR, constructing genome full length into 8 fragments, creating 6 restriction enzyme sites Pme I, pac I, asiS I, notI and SnaBI in NP, P, M, F and 3 '-untranslated region (3' -UTR) of HN gene respectively, creating SpeI and Sac II 2 enzyme cutting sites in L gene, deleting RsrII enzyme cutting sites on HN and L gene sequence by overlapping PCR;
(3) The fragments are cloned between the T7 promoter of the pBR322 plasmid and the HDV antigen group ribozyme sequence in sequence to obtain the plasmid pBR322-rF48E9.
The second technical scheme adopted by the invention is as follows:
A recombinant virus of type XI Newcastle disease is prepared by the preparation method as described above.
Furthermore, the XI type newcastle disease recombinant virus is obtained by mutating the P protein 386 R amino acid or 387 R amino acid of the XI type newcastle disease virus into alanine.
Furthermore, the P protein 386 R amino acid point mutation of the XI type newcastle disease recombinant virus is changed from arginine (R) to alanine (A) to obtain recombinant virus rF48E9/P (R386A), and the P protein 387 K amino acid point mutation is changed from lysine (K) to alanine (A) to obtain recombinant virus rF48E9/P (K387A).
Furthermore, the P protein coding gene sequence of the recombinant virus rF48E9/P (R386A) is shown as SEQ ID NO.2, and the P protein coding gene sequence of the rF48E9/P (K387A) is shown as SEQ ID NO. 3.
The third technical scheme adopted by the invention is as follows:
the application of the XI type newcastle disease recombinant virus in newcastle disease antibody or vaccine screening or evaluation.
The invention has the beneficial effects that:
The invention firstly constructs a reverse genetic operation system of XI type NDV strain, and successfully saves recombinant virus R386A, K387A with P protein amino acid point mutation through screening amino acid point mutation sites. Through virus virulence index measurement, the recombinant NDV with the two XI type P protein amino acid point mutations can weaken virus virulence, has stable genetic performance and no pathogenic ability to animals, and can reasonably infer that the NDV P protein plays a vital role in virus virulence. Experiments of the invention fully demonstrate that the P protein is linked with viral virulence. The implementation of the technical scheme of the invention lays a solid foundation for developing the NDV attenuated vaccine and researching the NDV related foundation.
DetailedâDescription
In order to clearly illustrate the technical features of the present solution, the present invention will be described in detail below with reference to the accompanying drawings.
Example 1 construction of transcription vector:
The invention provides a method for preparing a bacterial strain, which comprises the steps of taking BHK-21 cells as hamster kidney cells, taking 10% fetal bovine serum (ZITA) as a culture medium, saving an NDV F48E9 strain (GenBank: MG 456905) by a major animal epidemic prevention team of the university of North China agriculture and forestry science and technology animal medical college, and purchasing SPF chick embryos and SPF chicks from Shandong Tai laboratory animal breeding limited company.
The reverse genetic manipulation platform of the NDV F48E9 strain was constructed on a modified version of plasmid pBR322, i.e., pBR322/m, in which the fragment between the Asc I and Rsr II sites was removed and replaced by a 122nt oligonucleotide linker. An 84nt delta hepatitis virus (HDV) anti-genomic ribozyme sequence and a T7RNA polymerase transcription termination signal were inserted into the downstream end of the linker.
Linker was designed according to the desired cleavage site and ligated into linearization vector pBR322 (Asc I/Rsr II). The resulting plasmid was designated pBR322m/Linker and was used as the basis vector for the subsequent full length infectious cloning plasmid. The primer sequences were as follows:
Linker-F:
CGCGCCAAGCTTTGTTTAAACGGCCCTTAATTAAGGACGCGATCGCGTA
TAAGAATGCGGCCGCTAAACTATGCTACGTACCGGACTAGTCCTCCCCGC
GGGGATTCG
Linker-R:
GACCGAATCCCCGCGGGGAGGACTAGTCCGGTACGTAGCATAGTTTAGC
GGCCGCATTCTTATACGCGATCGCGTCCTTAATTAAGGGCCGTTTAAACAA AGCTTGGã
EXAMPLE 2 construction of full-length cDNA of NDV genome
To facilitate construction of the F48E9 strain infectious clone, the full-length F48E9 sequence was divided into eight fragments. Wherein Asc I and Rsr II are located in a cloning vector pBR322/m, pme I, pac I, asis I, not I and SnaB I are digested and introduced into a 3' UTR region of NP, P, M, F, HN through primers, sac II is located inside an L gene, HN (6493 bp) and L (13828 bp) are subjected to nonsense mutation to delete Rsr II through a Overlap PCR method, ACTAGG in the L gene is mutated into ACTAGT, and Spe I is introduced. The construction strategy is schematically shown in FIG. 1.
SEQ ID NO.1 shows the gene sequence of the NDV F48E9 strain P protein.
8 Pairs of primers are designed for amplifying the genome of the NDV F48E9 strain, and the sequences of the primers are as follows:
F1-F:
AGTTGGCGCGCCTAATACGACTCACTATAGGGACCAAACAGAGATTCTGT
GAGGTACGATAAAAAGC F1-R:
CCGGCGCGCCGTTTAAACTGTTGATGGGTCAAGTTGTGCCTGTGTTG F2-Fï¼AGCTTTGTTTAAACAGAACCAAAGACATTAGAAAAAAATACG F2-Rï¼TGCCTTAATTAAGGTTGCGCGATTATTTAATGAGATAGAGGAGG F3-Fï¼TGCCTTAATTAATCCTGCAACATTAATGATTAAGAAAAAATACGG F3-Rï¼ACGATTGCGATCGCGACAGATCATTATTTGGCGCCGTGGTG
F4-F:ACGATTGCGATCGCTTATAGTTAGCTCACCTGTCTATC
F4-R:ATAGTTTAGCGGCCGCAATTCACACACAAATTGCTCTTGGAGATAC F5-F:
ATAAGAATGCGGCCGCCTGTCAATTAGAAGAATTAAGAAAAAACTACC F5-Rï¼ATCAGGTACGTATATTTTTTCTTAATCAAGTGACTATTGGCAAG F6-Fï¼ATCAGGTACGTAGTAGTGAGATACGAGACAAAGCAACTCAC F6-Rï¼GGACTAGTTAAGATGTTAGTCATAATGCTAGGAC
F7-F:GGACTAGTCCACCTGGTAATGGAGATTGGGCCAG
F7-R:TCCCCGCGGATAAGCCTCTTATTTTCGGGATTTC
F8-F:TCCCCGCGGAAGAAAAATGTTCAGTACTCACTGAG
F8-R:
GGTCCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCACCAAACAA
AGATTTGGTGAATGACAGAAC
Design 2 nonsense mutation deletion of HN (6493 bp) and L (13828 bp) to delete Rsr II, mutation of ACTAGG in L gene to ACTAGT, introduction of Spe I, primer sequence as follows: delRsr II 6493-F: TTCGAACAGCAGTCTTACTTTTAATAGTAGTGACCTTTTC DELRSR II 6493-R:
GTCACTACTATTAAAAGTAAGACTGCTGTTCGAAATACCAAGCGC
CATGTATTTTTCG
delRsr II 13828-F:GGGCCAACCCCGACACAGTTCCTGAATTCAGTC
delRsr II 13828-R:
GACTGAATTCAGGAACTGTGTCGGGGTTGGCCCGAAATGTCGC
TGTGGGGGGTTCATC
Extracting genome RNA in allantoic fluid from NDV F48E9 chick embryo inoculated with Trizol method, and comprises the following steps:
â Adding 250 μL of chick embryo allantoic fluid, shaking and mixing, standing at room temperature for 5 min, adding 200 μL of chloroform into â¡ tubes, tightly covering a centrifuge tube, shaking vigorously for 15 seconds, standing at room temperature for 10 min, centrifuging at 4 â and 12000rpm for 15 min, adding 700 μL of isopropanol into â¢, standing at 20 â for 30min, centrifuging at 12000rpm for 10 min at 4 â, discarding supernatant by â£, adding 75% ethanol into each milliliter of Trizol fluid, mixing, centrifuging at 4 â and 7500g for 5 min, discarding supernatant by ⤠min, drying at room temperature for 5-10 min, taking care not to dry excessively, otherwise reducing the solubility of RNA, and finally dissolving RNA into water. After reverse transcription of RNA into cDNA, each gene fragment is amplified by PCR method, and the target fragment is recovered by cutting gel for standby.
The 8 fragments (F1-F8) of the whole genome are amplified by PCR according to the primers, the amplified target fragment is subjected to double digestion in a vector, and each gene fragment is cloned to a modified vector pBR322m/Linker through corresponding digestion sites. The positive plasmid of the constructed full-length infectious clone was designated pBR322-rF48E9. Open Reading Frame (ORF) cDNAs of NP, P and L genes are cloned into a pCI eukaryotic expression vector after being connected in series to construct helper plasmids pCI-NP, pCI-P and PCI-L, a T7RNA polymerase nucleotide sequence is synthesized by the genes, and the helper plasmids pCAGGS-T7 are cloned into pCAGGS. The cloned full-length cDNA of the corresponding genome is used as a transcription template of the negative strand RNA of the genome, and is used as a basis for establishing a DNA reverse genetic operation platform.
Example 3 construction of full-length cDNA for site-directed amino acid mutation of P protein 386Rã387 K of NDV F48E9 strain:
The construction scheme of the recombinant mutant virus infectious clone plasmid is shown in FIG. 2A.
As a result of previous studies, it was found that the host protein CARD11 interacts with the P protein and inhibits the activity of RNA polymerase of NDV virus, thereby inhibiting viral replication, and further studies have found that the specific amino acid site of interaction between the P protein and the CARD11 protein, i.e., 385IRKI388. Therefore, 4 (385Iã386Rã387Kã388 I) infectious clone plasmids of different point mutant viruses are constructed through experiments, wherein the P protein 386 R point mutation and 387 K point mutation vectors are connected with a target fragment, the viruses can be successfully saved after transformation, the virus virulence is obviously reduced, the genetic stability is good, and the 385Iã388 I point mutant recombinant viruses cannot be successfully saved.
According to the sequence of the full-length infectious cloning vector pBR322-rF48E9 of the NDV F48E9 strain, designing a primer required for constructing a P protein 385Iã386Rã387Kã388 I point mutation vector, wherein the construction of the vector is to amplify a point mutation fragment by using an overlap method, and then connect the amplified fragment with the vector by using a homologous recombination method, namely, 15-20bp of base homologous to the tail end of the vector after enzyme digestion needs to be added at the upstream and downstream of the primer. The desired point mutation primer sequences are as follows:
I385A-F:CGAAGAAGCCAGAAAAATCAAGCGCCTTG
I385A-R:GATTTTTCTGGCTTCTTCGATCGACCCG
R386A-F:AGAAATCGCAAAAATCAAGCGCCTTGCGC
R386A-R:CTTGATTTTTGCGATTTCTTCGATCGAC
K387A-F:AATCAGAGCAATCAAGCGCCTTGCGCTGA
K387A-R:GCGCTTGATTGCTCTGATTTCTTCGATC
I388A-F:CAGAAAAGCCAAGCGCCTTGCGCTGAATG
I388A-R:AAGGCGCTTGGCTTTTCTGATTTCTTCG
P Linker-F:
CACAACTTGACCCATCAACAGTTTAAACAGAACCAAAGACATTAGAAA
AAAATA P Linker-R:
ATCATTAATGTTGCAGGATTAATTAAGGTTGCGCGATTATTTAATGAG
The experimental method comprises the following steps:
(1) Amplifying target fragments by performing overlap PCR reaction with the primers and the template pBR322-rF48E9 to obtain the gene sequence of P protein 385Iã386Rã387Kã388 I single-point mutation into alanine (A). And (3) carrying out gel recovery on the target band with correct size after nucleic acid electrophoresis, and preserving at-20 â for standby.
(2) Double cleavage of infectious cloning vector the infectious cloning vector pBR322-rF48E9 was double cleaved with both Pac I and Mss I and incubated in a 37âwater bath for 60min. And (3) after the double enzyme-digested carrier is subjected to agarose gel electrophoresis gel cutting, the carrier is recovered by using a gel recovery kit, and then the carrier is connected with a target fragment.
(3) Ligation by homologous recombination with the target fragment and vector (200 ng) using a linearized infectious cloning vector (50 ng), 50ng of the target fragment, 2. Mu.L of Exnase IIl, 4. Mu.L of 5 XCE II Buffer, and 20. Mu.L of ddH 2 O at 37âfor 30min.
(4) Transformation into E.coli competent cells DH 10. Beta. After mixing 20. Mu.L of homologous recombination product, 10. Mu.L of 5 XKCM Buffer and 30. Mu.L of ddH 2 O. Placing on ice for 20min, standing at room temperature for 10min, adding high-pressure sterilized LB medium, shaking on an air shaking table at 30 â and 180rpm for 1h, centrifuging, removing part of supernatant, coating a proper amount of bacterial liquid on a LB solid culture plate with tetracycline resistance, and culturing at 30 â for about 18 h.
(5) Screening and identifying, namely after culturing for 12 hours, selecting monoclonal bacterial colonies into 5mL of tetracycline-resistant liquid LB, shaking the bacterial colonies on an air shaking table at 37 â and 230rpm for about 10 hours, namely culturing until the bacterial concentration reaches OD=0.8, and carrying out bacterial liquid PCR identification. Plasmids with correct sequencing were designated pBR322-rF48E 9P/(I385A), pBR322-rF48E 9P/(R386A), pBR322-rF48E 9P/(K387A), pBR322-rF48E 9P/(I388A) and stored at-20 â.
The experimental result shows that the P protein point mutation product amplified by overlap PCR has correct and bright band with 1494bp fragment size by using the infectious cloning vector pBR322-rF48E9 as a template and analyzing the nucleic acid gel electrophoresis, and the result is shown in figure 2B. The amplified fragments were respectively connected to the vector by homologous recombination, and the bacterial liquid extract plasmids positive for bacterial liquid PCR were sent to the company for sequencing and then aligned to show the same target sequence (FIG. 2C).
EXAMPLE 4 rescue of NDV F48E9 strain P protein 386Rã387 K site-directed amino acid mutant recombinant virus:
(1) Co-transfection BHK-21 cells were passaged one day in 6 well cell culture plates, co-transfected when cell density reached around 75% within 24h, and cell culture was performed according to the transfection mass ratio pBR322-rF48E9 or pBR322-rF48E 9P/(R386A) or pBR322-rF48E 9P/(K387A): pCAGGS-T7: pCI-NP: pCI-P: PCI-L=5:2:2:2:1, using TurboFect transfection kit (Thermo Fisher) operating according to kit instructions, cell culture was performed for approximately 4d. The unmutated infectious clone plasmid pBR322-rF48E9 was used as a positive control. Note that wells not transfected with infectious clone plasmid were set as negative controls.
(2) Chick embryo inoculation, in which whether cells have cytopathy or not is observed, and the time for harvesting cell supernatant is determined according to the cell state, and the time is about 3-4 days for harvesting. Inoculating the obtained supernatant into allantoic cavity of 9-11 day old SPF chick embryo, each chick embryo needs to be connected with about 200 μL, placing into incubator, discarding the chick embryo dead within 24h, and harvesting chick embryo allantoic liquid after 3d, and performing Hemagglutination (HA) experiment.
(3) HA assay 50. Mu.L of allantoic fluid was used for the Hemagglutination Assay (HA) according to conventional methods. The HA valence of different chick embryos is 2 6-8, and F48E9 strain P protein 386 R site-directed amino acid mutant recombinant virus rF48E 9P/(R386A), P protein 387 K site-directed amino acid mutant recombinant virus rF48E 9P/(K387A) and control virus rF48E9 are obtained.
(4) Experimental results after co-transfection of the rescue plasmid system into BHK-21 cells, lesions were observed on day 3 in cells transfected with pBR322-rF48E9/P (R386A), pBR322-rF48E9/P (K387A) and positive control pBR322-rF48E9 (fig. 3A), with no lesions in the remaining 3 wells. Cell supernatants from all wells were harvested on day 4, allantoic fluid was harvested after chick embryos were inoculated, and HA measurements indicated positive rF48E9/P (R386A), rF48E 9P/(K387A) and rF48E9 titers of 2 8ã28 and 2 7, respectively.
In the experiment of the invention, rF48E 9P/(I385A) and rF48E 9P/(I388A) are not successfully rescued, and on the premise of ensuring that all test materials are accurate, many attempts are made, such as that positive viruses are not generated in a plurality of test operations (up to 20 times), the test operations are not successful by changing different experimenters, the rescue is not successful by changing cells, and the like. We speculate that the two isoleucine (I) s of 385Iã388 I play a key role in the spatial structure of the viral P protein or the functional role of the P protein, thereby affecting the transcriptional replication or assembly of the virus. The role of these two sites requires further investigation.
Example 5 identification of ndv f48e9 strain P protein 386Rã387 K site-directed amino acid mutant recombinant virus:
The F48E9 strain P protein 386Rã387 K site-directed amino acid mutant recombinant virus rF48E 9P/(R386A), rF48E 9P/(K387A) and control virus rF48E9 are respectively passaged to 10 th generation by using 9-day-old SPF chick embryo, RNA of the 10 th generation virus is extracted, reverse transcription is carried out to obtain cDNA, then target fragments are amplified, and the target fragments are recovered by cutting glue and are subjected to sample feeding sequencing.
Experimental results show that mutation of 386 th amino acid mutation sites of the P protein of the rF48E9/P (R386A) strain and mutation of 1156 th and 1157 th nucleotide sequences of nucleotide sequences still exist, which indicates that the genetic stability of the rF48E9/P (R386A) strain of the recombinant mutant virus is good, and mutation of 387 th amino acid mutation sites of the P protein of the rF48E 9P/(K387A) strain, i.e. mutation of 1159 th and 1160 th nucleotide sequences still exist, which indicates that the genetic stability of two recombinant mutant viruses is good (figure 3B).
Example 6 analysis of biological Properties of recombinant viruses with site-directed amino acid mutations in the P protein 386Rã387 K of NDV F48E9 strain:
experimental method one viral virulence assay
(1) The average time (MDT) of the minimum lethal dose virus-killing chick embryo is determined by continuously diluting fresh allantoic fluid into 10 -6ï½10-9 by 10 times with sterilized normal saline, inoculating 5 SPF chick embryos 9-10 days old to each dilution through allantoic cavity, inoculating 0.1mL each chick embryo, culturing at 37 â, preserving the rest virus dilution at 4 â, inoculating another 5 chick embryos each dilution after 8 hours, inoculating 0.1mL each chick embryo, culturing at 37 â, illuminating eggs twice a day, continuously observing for 7 days, and recording the death time of each chick embryo, wherein the minimum lethal dose refers to the maximum dilution capable of causing death of all chick embryos inoculated with the dilution, and the MDT refers to the average time (h) for which the minimum lethal dose causes death of all chick embryos, and the calculation formula is as follows:
Wherein:
NX-number of embryos dead in X hours;
nyâthe number of embryos dead in Y hours;
X (Y) -embryo death time (h);
T-total number of embryos dead.
(2) The in-brain inoculation pathogenicity index (ICPI) of 1-day-old SPF chicks is determined by taking fresh infected allantoic fluid (not more than 24-48 h, negative in bacterial test) with HA titer higher than 1:16, 10 times dilution with sterile isotonic saline, 10 total SPF chicks inoculated in the brain and out of the shell for 24-40 h, 0.05mL each, once every 24h observation for 8 days, daily observation should be scored for chickens, normal chickens are marked as 0, sick chickens are marked as1, dead chickens are marked as 2 (each dead chicken still marks 2 in daily observation after death), ICPI is the average of all observed values in 8 days of each chicken, and the formula is calculated as follows:
Wherein:
sigma s, 8 days of accumulated morbidity;
Sigma d-8 days accumulated death number;
t-total number of chickens was cumulatively observed for 8 days.
As a result of the experiment, MDT values of rF48E9/P (R386A), rF48E 9P/(K387A) and rF48E9 strains were 69.7h, 75.35h and 52.0h, respectively. ICPI values for rF48E9/P (R386A), rF48E 9P/(K387A) and rF48E9 strains were 1.50, 1.5625 and 2.0, respectively. The results show that the recombinant mutant viruses rF48E9/P (R386A) and rF48E 9P/(K387A) are moderate virulent strains, and rF48E9 is a virulent strain and unchanged compared with the virulent strain F48E 9. 386Rã387 The virulence of the virus after K mutation was reduced, and the virulence of the virus after 387 K mutation was weaker.
Experimental methods II viral plaque
The BHK-21 cells are paved into a 6-hole cell culture plate in advance 1d, when the cell density reaches about 75% in 24h, allantoic fluid containing recombinant viruses is diluted into 10 -4ï½10-7 infected cells by sterilized normal saline continuously 10 times, 2mL of 1% methylcellulose cell culture medium is covered on each hole, the cells are cultured in a cell culture box, and when the formed virus plaque is not increased any more, the cells are harvested. After slowly discarding the medium, fixing with methanol for 10min, washing with PBS, adding appropriate amount of 0.1% crystal violet for 20min, washing with running water, drying, photographing, and recording data.
The results of the experiment are shown in FIG. 4A for plaque produced by recombinant viruses. Data analysis of the formed plaques showed that the recombinant mutant viruses rF48E9/P (R386A) and rF48E 9P/(K387A) formed plaques with significantly smaller diameters (left in FIG. 4B) and areas (right in FIG. 4B) than the control virus rF48E9, indicating reduced syncytia formation capacity of the recombinant mutant viruses rF48E9/P (R386A) and rF48E 9P/(K387A).
Experimental methods III Virus growth Properties
(1) Virus infection experiments recombinant virus infected BHK-21 cells, the experimental procedure was followed by plating cell counts one day in advance, discarding the cell supernatant the next day, and washing twice with sterile PBS. After the recombinant viruses are uniformly mixed with serum-free DMEM (GIBCO) medium at an infectious dose of 0.01MOI, a virus diluent is slowly added into each hole of the cell culture plate, and the cell culture plate is placed at 37 â for 1-2 hours, and the culture plate is gently rocked during the process, so that the viruses are uniformly adsorbed. The virus suspension was discarded and washed twice with sterile PBS. DMEM cell culture medium containing 2% serum was added and placed in a cell culture incubator. After the inoculation, the cytopathic effect needs to be observed every 12 hours, and the result is recorded by photographing. And collecting a 36-hour cell sample, and detecting the expression condition of each protein of the virus in the cell by Western blot.
(2) Virus titer assay the supernatant was collected every 12h after infection of the cells with virus and half the tissue culture infection dose (TCID 50) was determined. The method comprises spreading BHK-21 cells into 96-well cell culture plate one day in advance, and observing cell state preferably at 70-85% density. The harvested cell supernatants were serially diluted 10-fold to 10 -1ï½10-8 with serum-free DMEM medium, and each dilution was repeated for at least three groups. Every dilution gradient must be changed and the tip must be added along the side wall of the centrifuge tube during sample addition, and the pipette tips cannot touch the culture solution. The 96-well culture plate is discarded, and the culture plate is too porous to be discarded once, so that the death of cells due to drying is avoided. When sucking liquid, the suction head should not touch the bottom of the 96-well plate. Diluted toxic medium was added in order from low concentration to high concentration, 100. Mu.L per well. After 1h, the toxic medium was discarded and 100. Mu.L per well of 2% serum DMEM medium was added. And (5) placing the cells in a cell culture box for culturing for about 2-3 days, taking out an observation result, taking the latest time of survival of the non-toxic cells as the last observation time, and taking the obtained result as the final result.
TCID 50/mL was calculated using the Reed-Muench method.
Experimental results after the recombinant mutant viruses rF48E9/P (R386A), rF48E 9P/(K387A) and recombinant wild viruses rF48E9 are respectively infected with BHK-21 cells at a dose of 0.01MOI, cytopathic effect is observed, and the recombinant wild viruses rF48E9 can observe syncytia at 12hpi, the 24hpi syncytia is obvious, and the 48hpi cells are all dead. After the two recombinant mutant viruses are infected, the number of cell nuclei fused to form syncytia is obviously less, the 36hpi cells are subjected to vesicular degeneration, the 60hpi cells are all dead and 12 hours later than rF48E9, which shows that the 386 th and 387 th amino acids of the recombinant mutant virus P protein are mutated and can delay cytopathy compared with the non-mutated protein, the syncytia forming ability is weakened, and the cytopathy generating ability is reduced. The results of virus titer measurements on every 12h of harvested cell samples showed a slight decrease but no significant difference in the proliferation capacity of recombinant viruses rF48E9/P (R386A), rF48E 9P/(K387A) in BHK-21 cells (FIG. 5).
Example 7 pathogenic properties of recombinant viruses:
The aim of the experiment is to detect the pathogenicity of XI type newcastle disease virus P protein 386Rã387 K amino acid point mutation recombinant virus to SPF chicken, which is saved by reverse genetic technology.
The experimental method comprises the following steps:
(1) Challenge procedure 15 SPF white space chickens, 4 weeks old, were randomly divided into 3 groups of 6 per experimental group and 3 negative control groups. The recombinant virus rF48E9 (10 5 pfu/100. Mu.L) was inoculated by eye-drop and nose-drop, one group of chickens was tested, two groups of chickens were tested for recombinant mutant virus rF48E9/P (R386A) (10 5 pfu/100. Mu.L), and three groups of chickens were tested for recombinant mutant virus rF48E9/P (K387A) (10 5 pfu/100. Mu.L). Three groups of chickens were raised in 3 isolators, respectively, to provide sufficient water and feed. Each group of chickens was observed 2 times daily, clinical symptoms were observed, and survival rates of chickens were counted.
(2) Animal tissue collection and treatment, namely taking tissue organs of each group of dead chickens, fixing a part of all collected tissues by 4% paraformaldehyde for histopathological analysis, and determining the viral load of each tissue by using a part of the collected tissues as TCID 50. The hands are sterilized before sampling, the metal and glass instruments are sterilized by high-pressure steam, and the white porcelain plate is sterilized by alcohol, so that animals are fixed on the white porcelain plate. The sampling can be performed at an ultra clean bench. During sampling, the scissors forceps are sterilized after the target tissue is found, sampling is performed again, and sterilization is performed once again after sampling, so that the next tissue can be collected. When in disinfection, firstly, the blood and dirt on the scissors and the tweezers are wiped clean by the alcohol cotton ball, the scissors and the tweezers are put on the outer flame of the alcohol lamp for burning and sterilization, and are put into 75% alcohol for standby, and the scissors and the tweezers are burned again before being used, and can be used when the scissors and the tweezers are cooled to room temperature. The sample taken out should be placed into a 1.5mL centrifuge tube as soon as possible, and the tissue type and sampling time should be marked.
(3) Tissue HE staining after fixing the harvested tissue with 4% paraformaldehyde overnight, paraffin embedding, sectioning and HE staining were performed by siegesbeck biotechnology limited.
(4) Tissue viral load the weight of each tissue organ harvested is recorded, typically 600 μl PBS solution per 0.2g tissue. After grinding the tissue according to the instructions of the grinder, the low-temperature centrifuge is at 6000rpm and centrifuged for 5min. The supernatant was aspirated into a fresh sterile 1.5mL EP tube, and diabody (penicillin and streptomycin, 5000 IU/mL) was added overnight at 4 â. Subsequently, the supernatant was centrifuged at 6000rpm at low temperature for 5min and the TCID 50/mL experiment was performed in a sterile EP tube. The harvested tissue-milled supernatants were serially diluted 10-fold to 10 0ï½10-7 with serum-free DMEM medium, each dilution was repeated for at least three groups, inoculated into BHK-21 cells plated one day in advance, TCID 50/mL was determined, the results observed and the data recorded.
Experimental results (1) rF48E9 infected chicks showed mild symptoms of mental depression and open mouth respiration at 2dpi, 3 chicks died at 3dpi, and the rest chicks had rarefaction of feces, anorexia, liquid filled crop and leg paralysis, and all the chicks died at 5 dpi. However, until 10dpi, no obvious clinical symptoms were observed in chicks infected with rF48E9/P (R386A) and rF48E9/P (K387A). Chicken experiments in PBS control group were healthy throughout. The result shows that the mortality rate of rF48E9 is 100%, and rF48E9/P (R386A) and rF48E9/P (K387A) are not lethal to 4-week-old chicks. The survival curves are shown in FIG. 6A. (2) The chicken with the dead chicken is cut, the crop of the chicken infected by rF48E9 is filled with thin liquid and gas, the lung is visible as edema, the brain parenchyma has no eye sight change, the spleen has necrotic foci, the duodenal bleeding is most obvious, the glandular stomach nipple has bleeding points, the bursa of Fabricius is edematous, and the liver and the kidney have no special pathological changes. Chicks infected with rF48E9/P (R386A) and rF48E9/P (K387A) were examined randomly at 6dpi, and no abnormal pathological changes in the organized organs were found. Each tissue organ lesion is shown in FIG. 6B. (3) As shown in FIG. 6C, rF48E9 was able to proliferate in each tissue and organ harvested and was higher in replication capacity than rF48E9/P (R386A) and rF48E9/P (K387A). These results indicate that the mutant strain has a reduced viral replication capacity compared to the wild-type strain in vivo. (4) As shown in FIG. 6D, the HE staining results show that the pathological changes of the tissues infected by rF48E9 are obvious, the tissues of the duodenum, the adenoma stomach, the myoma stomach and the trachea are all bleeding, the tissue of the duodenum is most seriously bleeding, the tissue cells of the duodenum and the adenoma stomach are obviously denatured and necrotized, the tissue of the myoma stomach is slightly infiltrated by inflammatory cells, the brain and cerebellum tissues are subjected to the phenomenon of blood vessel sleeve, the pathological changes of the tissues infected by rF48E9/P (R386A) and rF48E9/P (K387A) are obviously relieved, only slight bleeding is caused in the brain and the adenoma stomach, the tissue cells of the duodenum and the adenoma stomach are slightly denatured and necrotized, and no obvious pathological changes are seen in the cerebellum, the myoma stomach and the trachea.
The above embodiments are not to be taken as limiting the scope of the invention, and any alternatives or modifications to the embodiments of the invention will be apparent to those skilled in the art and fall within the scope of the invention.
The present invention is not described in detail in the present application, and is well known to those skilled in the art.
RetroSearch is an open source project built by @garambo | Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4