The invention provides a monoclonal antibody combined with T7RNA polymerase and a preparation method thereof, belonging to the field of immunity. The monoclonal antibody which is combined with T7RNA polymerase can be used for detecting the residual T7RNA polymerase in the production process of mRNA vaccine.
Description Monoclonal antibody of T7RNA polymerase and preparation method thereofTechnical Field
The invention belongs to the field of immunology, and particularly relates to a monoclonal antibody of T7RNA polymerase. The invention also relates to a preparation method and application of the monoclonal antibody.
Background
mRNA is "messenger ribonucleic acid". As a messenger, mRNA serves the primary function of transmitting transcribed DNA information, and template commands for the production of various proteins. When this instruction is received by the "factory" that processes proteins in human cells, the protein synthesis process is initiated. In the end of 1987, Robert Malone mixed mRNA with fat droplets and found that human cells could take up these mRNA added to the fat droplets and produced proteins (Malone et al Sci. USA86, 6077-6081 (1989)). This discovery was the first successful attempt to express mRNA in vivo, and also demonstrated the feasibility of mRNA vaccines. Since then, over 30 years of research development, significant technological innovation and research investment made mRNA an important tool in the fields of vaccine development and cancer treatment.
In order to deal with the new crown epidemic situation, five technical routes of inactivated vaccine, recombinant vaccine, adenovirus vector vaccine, attenuated influenza virus vector vaccine and nucleic acid vaccine are carried out in the market at present. Compared with the traditional vaccine, the mRNA vaccine has remarkable advantages, and in terms of pharmacological characteristics, after entering a human body through a specific delivery system, the mRNA vaccine utilizes a transcription and translation system of the human body to generate proteins with specific immunogenicity, and after the proteins are recognized by Antigen Presenting Cells (APC), the maturation of the dendritic cells of the induced trees further activates B cells and T cells to generate strong immune response, so that humoral and cellular double immune response is triggered, and immune memory is formed. Few conventional vaccines have been reported to produce cellular immunity. From the production process, the mRNA vaccine has the obvious advantages of simple production process, high development speed, no need of cell culture, low cost and the like.
At present, the mRNA vaccine development process comprises pathogen recognition, sequencing, mRNA in vitro synthesis and modification, purification and other operations. In vitro synthesized RNA (IVT) is mainly obtained by in vitro transcription with DNA as a template, and is usually synthesized by in vitro transcription with RNA polymerase by using linearized plasmid DNA or PCR amplification products as a template. The main process is that DNA containing T7 promoter (TAATACGACTCACTATAGGG) or SP6 promoter (ATTTAGGTGACACTATAG) sequence is used as a template, NTP is used as a substrate to synthesize mRNA which is complementary with one strand of the template DNA under the condition of containing T7 or SP6 RNA polymerase, a large number of mRNA molecules are simply and rapidly obtained, and the stability of the mRNA is enhanced by adding a cap structure at the 5 'end and adding a ployA tail at the 3' end. Among these, the efficacy exerted by T7RNA polymerase is not insignificant. The bacteriophage T7RNA polymerase (T7RNAP) was first isolated in 1970 from E.coli infected with bacteriophage T7, is one of the simplest enzymes catalyzing RNA synthesis, has a molecular weight of 98kDa, and is widely used in industrial technology because it is a single subunit enzyme, has high specificity for the T7 promoter, does not require additional protein factors to complete the transcription cycle, has a high extension rate, and can produce very long transcripts.
The residual detection of T7RNA polymerase is also an important link, and therefore, the development of a monoclonal antibody for detecting the residual of T7RNA polymerase with high sensitivity and high specificity is imminent.
Disclosure of Invention
The invention aims to provide an isolated antibody or an antigen-binding fragment thereof, which specifically binds to T7RNA polymerase, for detecting residual T7RNA polymerase in the production process of mRNA vaccines.
In a first aspect of the invention, there is provided an isolated antibody or antigen-binding fragment thereof comprising:
(a) a heavy chain variable domain (VH) comprising:
heavy chain complementarity determining region 1(HCDR1) of the amino acid sequence shown in SEQ ID NO. 1, HCDR2 of the amino acid sequence shown in SEQ ID NO. 2, and HCDR3 of the amino acid sequence shown in SEQ ID NO. 3; and
(b) a light chain variable domain (VL) comprising:
light chain complementarity determining region 1(LCDR1) of the amino acid sequence shown in SEQ ID NO. 4, LCDR2 of the amino acid sequence shown in SEQ ID NO. 5, and LCDR3 of the amino acid sequence shown in SEQ ID NO. 6;
wherein the antibody or antigen binding fragment thereof is capable of specifically binding to T7RNA polymerase, preferably wild-type T7RNA polymerase, more preferably T7RNA polymerase comprising the amino acid sequence set forth in SEQ ID NO. 11.
In some embodiments, the isolated antibody or antigen-binding fragment thereof, wherein the VH comprises the amino acid sequence set forth in SEQ ID NO. 7 and the VL comprises the amino acid sequence set forth in SEQ ID NO. 8.
In some embodiments, the isolated antibody or antigen-binding fragment thereof is rodent, chimeric, human, partially humanized, or fully humanized.
In some embodiments, the isolated antibody or antigen-binding fragment thereof is murine.
In some embodiments, the isolated antibody or antigen-binding fragment thereof comprises a heavy chain constant domain (CH) of the amino acid sequence set forth in SEQ ID NO. 9 and a light chain constant domain (CL) of the amino acid sequence set forth in SEQ ID NO. 10.
In a second aspect of the invention, there is provided a method of making the isolated antibody or antigen-binding fragment thereof of the first aspect.
In some embodiments, the hybridoma cells obtained by hybridoma fusion after obtaining splenocytes from a mouse immunized with T7RNA polymerase as an antigen are screened for hybridoma cells that secrete an antibody that binds T7RNA polymerase; sequencing the hybridoma cell to obtain the variable domain and constant domain amino acid sequence and nucleic acid sequence of the antibody, and recombining and expressing the required antibody according to the sequence information.
In some embodiments, the T7RNA polymerase is wild-type, preferably the amino acid sequence of the T7RNA polymerase is shown in SEQ ID No. 11.
In a third aspect of the invention, there is provided a kit comprising an isolated antibody or antigen-binding fragment thereof according to the first aspect of the invention, and a second isolated antibody or antigen-binding fragment thereof capable of binding to the T7RNA polymerase; wherein the second isolated antibody or antigen binding fragment thereof binds to a different epitope of the T7RNA polymerase than the isolated antibody or antigen binding fragment thereof.
In some embodiments, the isolated antibody or antigen-binding fragment thereof comprises: (a) a heavy chain variable domain (VH) comprising: heavy chain complementarity determining region 1(HCDR1) of the amino acid sequence shown in SEQ ID NO. 1, HCDR2 of the amino acid sequence shown in SEQ ID NO. 2, and HCDR3 of the amino acid sequence shown in SEQ ID NO. 3; and (b) a light chain variable domain (VL) comprising: light chain complementarity determining region 1(LCDR1) of the amino acid sequence shown in SEQ ID NO. 4, LCDR2 of the amino acid sequence shown in SEQ ID NO. 5, and LCDR3 of the amino acid sequence shown in SEQ ID NO. 6; wherein the antibody or antigen binding fragment thereof is capable of specifically binding to T7RNA polymerase, preferably wild type T7RNA polymerase, more preferably T7RNA polymerase comprising the amino acid sequence shown in SEQ ID NO. 11.
In some embodiments, the VH comprises the amino acid sequence shown in SEQ ID NO. 7 and the VL comprises the amino acid sequence shown in SEQ ID NO. 8.
In some embodiments, the isolated antibody or antigen-binding fragment thereof further comprises a heavy chain constant domain (CH) of the amino acid sequence set forth in SEQ ID NO. 9 and a light chain constant domain (CL) of the amino acid sequence set forth in SEQ ID NO. 10.
In a fourth aspect of the invention, there is provided another kit comprising the isolated antibody or antigen-binding fragment thereof of the first aspect and comprising a second isolated antibody or antigen-binding fragment thereof capable of binding to the T7RNA polymerase; wherein the second isolated antibody or antigen-binding fragment thereof binds the T7RNA polymerase noncompetitively to the isolated antibody or antigen-binding fragment thereof.
In some embodiments, the isolated antibody or antigen-binding fragment thereof comprises: (a) a heavy chain variable domain (VH) comprising: heavy chain complementarity determining region 1(HCDR1) of the amino acid sequence shown in SEQ ID NO. 1, HCDR2 of the amino acid sequence shown in SEQ ID NO. 2, and HCDR3 of the amino acid sequence shown in SEQ ID NO. 3; and (b) a light chain variable domain (VL) comprising: light chain complementarity determining region 1(LCDR1) of the amino acid sequence shown in SEQ ID NO. 4, LCDR2 of the amino acid sequence shown in SEQ ID NO. 5, and LCDR3 of the amino acid sequence shown in SEQ ID NO. 6; wherein the antibody or antigen binding fragment thereof is capable of specifically binding to T7RNA polymerase, preferably wild-type T7RNA polymerase, more preferably T7RNA polymerase comprising the amino acid sequence set forth in SEQ ID NO. 11.
In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO. 7 and the VL comprises the amino acid sequence set forth in SEQ ID NO. 8.
In some embodiments, the isolated antibody or antigen-binding fragment thereof further comprises a heavy chain constant domain (CH) of the amino acid sequence set forth in SEQ ID NO. 9 and a light chain constant domain (CL) of the amino acid sequence set forth in SEQ ID NO. 10. In a fifth aspect of the present invention, there is provided a method for detecting T7RNA polymerase residues in the preparation of an mRNA vaccine, wherein the method comprises detecting T7RNA polymerase residues using the isolated antibody or antigen binding protein and the kit.
In a sixth aspect, the invention provides the use of the above antibody or antigen binding protein, and a kit comprising the above antibody or antigen binding fragment in the production of an mRNA vaccine. The application of the mRNA vaccine in the production of the vaccine refers to the application in each link of the vaccine production, including but not limited to the production process and the production completion, and the antibody or the antigen binding fragment and the kit thereof can be used for removing residual T7RNA polymerase under the condition that the residual T7RNA polymerase is involved in any production link.
In a seventh aspect of the invention, the use of the aforementioned kit in enzyme-linked immunosorbent assay is provided.
The invention also provides nucleic acids encoding the isolated antibodies or antigen-binding fragments thereof; the invention also provides a vector comprising said nucleic acid, capable of expressing said nucleic acid of the isolated antibody or antigen-binding fragment thereof; the invention also provides a host cell comprising the vector.
The amino acid sequence information of the present invention is shown in table 1:
TABLE 1 amino acid sequence
Term(s) for
It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
The term "epitope" means a protein determinant capable of specifically binding to an antibody. Epitopes are usually composed of chemically active surface groups of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics as well as specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that binding to the former, but not the latter, is lost in the presence of denaturing solvents.
The terms "antibody," "antibody portion," "antigen-binding fragment," or "antibody construct" are used in the broadest sense and encompass a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), full-length antibodies, and antigen-binding fragments thereof, so long as they exhibit the desired antigen-binding activity.
The basic 4 chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. IgM antibodies consist of 5 elementary heterotetramer units and an additional polypeptide called the J chain and contain 10 antigen binding sites, while IgA antibodies comprise 2-5 elementary 4 chain units that can polymerize to form multivalent aggregates in combination with the J chain. In the case of IgG, the 4-chain unit is typically about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds, depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has one variable domain (VH) at the N-terminus, followed by three constant domains (CH) for each alpha and gamma chain and four CH domains for the mu and epsilon isotypes. Each L chain has a variable domain (VL) at the N-terminus, followed by a constant domain at its other terminus. VL is aligned with VH and CL is aligned with the first constant domain of the heavy chain (CH 1). It is believed that particular amino acid residues form an interface between the light chain variable domain and the heavy chain variable domain. VH and VL pair together to form a single antigen binding site. For the structure and properties of different classes of antibodies see, for example, Basic and Clinical Immunology, 8 th edition, Daniel p.sties, Abba i.terr and tristramg.parsolw (ed.), Appleton & Lange, Norwalk, conn.,1994, page 71 and chapter 6. The L chain from any vertebrate species can be assigned to one of two distinctly different types (termed κ and λ) depending on the amino acid sequence of its constant domain. Depending on the amino acid sequence of its heavy chain constant domain (CH), immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, which have heavy chains designated α, δ, ε, γ and μ, respectively. The γ and α classes are further divided into subclasses based on the relatively small differences in CH sequence and function.
An "isolated" antibody is one that has been identified, isolated and/or recovered from a component (e.g., native or recombinant) of its production environment. Preferably, an isolated polypeptide is not associated with all other components from its production environment. Contaminating components of their production environment (such as those produced by recombinant transfected cells) are substances that generally interfere with the research, diagnostic, or therapeutic uses of antibodies, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. Isolated antibodies include antibodies in situ within recombinant cells, in which at least one component of the antibody's natural environment will not be present. Typically, however, an isolated polypeptide, antibody or construct will be prepared by at least one purification step.
The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of a heavy or light chain of the antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL", respectively. These domains are usually the most variable parts of an antibody (relative to other antibodies of the same class) and contain an antigen binding site.
The term "variable" refers to the fact that certain segments of a variable domain differ greatly in sequence between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the variable domains. Instead, it is concentrated in three segments called Complementarity Determining Regions (CDRs) or hypervariable regions (HVRs) in the light chain variable domain and the heavy chain variable domain. The more highly conserved portions of the variable domains are called Framework Regions (FR). The variable domains of native heavy and light chains each comprise four FR regions, predominantly in a β -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the β -sheet structure. The CDRs in each chain are held together tightly by the FR region and, together with the CDRs in the other chain, contribute to the antigen-binding site of the antibody (see Kabat et al, Sequences of Immunological Interest, fifth edition, National Institute of Health, Bethesda, Md. (1991)). The constant domains are not directly involved in binding of the antibody to the antigen, but exhibit a variety of effector functions, such as participation of the antibody in antibody-dependent cellular cytotoxicity.
As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations and/or post-translational modifications (e.g., isomerization, deamidation) that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are advantageous in that they are synthesized by hybridoma cultures and are free of contamination by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, Monoclonal Antibodies for use according to the present application can be prepared by a variety of techniques including, for example, the Hybridoma method (e.g., Kohler and Milstein, Nature,256:495-97 (1975); Hongo et al, Hybridoma,14(3):253-260 (1995); Harlow et al, Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2 nd edition 1988); Hammerling et al, Monoclonal Antibodies and T-Cell Hybridoma 563-681(Elsevier, N.Y., 1981)); recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567); phage display techniques (see, e.g., Clackson et al, Nature,352:624-628 (1991); Marks et al, J.mol.biol.222: 581-.
The term "constant domain" refers to a portion of an immunoglobulin molecule that has a more conserved amino acid sequence relative to another portion of the immunoglobulin (i.e., a variable domain), which contains an antigen binding site. The constant domain contains the CH1, CH2, and CH3 domains of the heavy chain (collectively referred to as CH) and the CHL (or CL) domain of the light chain.
The term "complementarity determining regions" or "CDRs" is used to refer to hypervariable regions defined by the Kabat system. See Kabat et al, Sequences of proteins of immunological Interest, published Health Service 5, National Institutes of Health, Bethesda, Md. (1991).
As used herein, the terms "specifically binds," "specifically recognizes," or "specific for ⦠â¦" refer to a measurable and reproducible interaction such as binding between a target and an antigen binding protein (such as a mAb) that determines the presence of the target in the presence of a heterogeneous population of molecules including biomolecules. For example, an antigen binding protein (such as a mAb) that specifically binds a target (which may be an epitope) is one that binds this target with greater affinity, avidity, more easily, and/or for a longer duration than it binds other targets (such as a mAb). In some embodiments, the extent of binding of an antigen binding protein (such as a mAb) to an unrelated target is less than about 10% of the binding of the antigen binding protein (such as a mAb) to the target, as measured, for example, by a Radioimmunoassay (RIA). In some embodiments, an antigen binding protein, such as a mAb, that specifically binds a target has the following dissociation constant (KD): less than or equal to 10-5M, less than or equal to 10-6M, less than or equal to 10-7M, less than or equal to 10-8M, less than or equal to 10-9M, less than or equal to 10-10M, less than or equal to 10-11M, or less than or equal to 10-12M. In some embodiments, the antigen binding protein specifically binds to an epitope on the protein that is conserved among proteins from different species. In some embodiments, specific binding may include, but is not required to be, exclusive binding.
Brief Description of Drawings
FIG. 1 shows the SDS-PAGE result of the full-length anti-T7 RNA polymerase monoclonal antibody.
FIG. 2 is a graph showing the results of binding of the best-functioning T7RNA polymerase monoclonal antibody to T7RNA polymerase.
Detailed Description
Example 1 preparation of T7RNA polymerase antibody
Mice were immunized with T7RNA polymerase, first 100ug, second 50ug, third 50ug, and fourth 50ug, Hybridoma cells were prepared, and hybridomas numbered E9-6, E9-7, E9-8, E9-10, E9-12, and E9-15 were selected, followed by Hybridoma cell cloning (Proetzel, Gabrile; Ebersbach, Hilmar (2012) [ Methods in Molecular Biology ] Antibody Methods and Protocols Volume 901| | Hybridoma Technology for the Generation of Monoclonal antibodies 10.1007/978-1-931 61779 (Chapter 7), 117-.
T7RNA polymerase amino acid sequence:
MNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA
EXAMPLE 2 expression and purification of monoclonal antibodies
The hybridoma selected in example 1 is lysed to extract mRNA, the mRNA is subjected to reverse transcription to form cDNA, after one round of amplification of the cDNA, IgG heavy chain gene segments and IgG light chain gene segments are called, and then the called IgG heavy chain gene segments and IgG light chain gene segments are spliced into an expression vector to construct plasmids.
The plasmid adopts ExpicCHO TM Reagent co-transfects HEK293 suspension culture cells for transient expression. Cell density was maintained at 6X 10 at transfection 6 cells/mL, ExpicHO TM Reagent: DNA (plasmid) ratio was 4: 1. Cells were incubated at 37 â with 8% CO 2 Shaking culture is carried out in an incubator at 120 r/min. 16-18h after transfection, 180. mu.L Expifeacmine was added TM CHO Enhance and 4.8mL ExpicHO TM Feed was then transferred to 32 â, 5%, 120rpm shake culture. Cell supernatants were collected 11 days after transfection. The purification was carried out after filtration through a 0.22 μm filter. Prior to purification, the tubing and protein A column were depyrogenated with 0.2M NaOH. The column was re-equilibrated with a buffer containing 0.05M Tris and 1.5M NaCl (pH 8.0). The harvested cell culture supernatant was then diluted with 2 à buffer 1:1 as described above and filter sterilized. The filtered supernatant and the protein A column were incubated at room temperature for 2 hours, and after washing the column with 1 à the above buffer, IgG was eluted using sterile 0.1M sodium citrate (pH3.5), and the eluate was collected and neutralized with one-ninth volume of sterile 1M Tris-HCl (pH 9). Under sterile conditions, the product buffer was exchanged for PBS (ph7.4) to remove any elution buffer and concentrate the sample. After concentration, the antibody was quantified by OD280nm using an extinction coefficient Ec of 1.43 (0.1%).
Antibodies were numbered along with the numbering of the hybridomas, and purified E9-6, E9-7, E9-8, E9-10, E9-12, E9-15 antibodies were analyzed by SDS-PAGE under 50mM dithiothreitol reduction conditions using 10% pre-gel (GenScript) by a BioRad electrophoresis system. The gel was stained with estain2.0(GenScript) and the molecular size was estimated by comparing the stained bands to Protein Ladder (GenScript). The results in FIG. 1 show that the E9-6, E9-7, E9-8, E9-10, E9-12, and E9-15 antibodies all exhibit two bands with molecular weights of 50kDa and 25kDa, respectively, the heavy and light chains of the antibody. Lane 1: e9-6; lane 2: e9-7; lane 3: e9-8; lane 4: e9-10; lane 5. E9-12; lane 6: e9-15; lane 8: and (3) protein maker.
Example 3 validation of binding Activity of T7RNA polymerase monoclonal antibody
The following experiments were all carried out using the panel novacell T7RNA Polymerase ELISA kit (Cat No. HG-TP 001).
1. Coating antigen: 2ug/ml of T7RNA polymerase was added to the wells of the plate 100. mu.L per well using a coating solution, the plate was coated overnight at 4 â with a lid, and the upper layer was liquid, and the coated T7RNA polymerase was adsorbed onto the plate.
2. And (3) sealing: washing the reaction plate once by 350 mu L of washing liquid per hole to wash out the coating liquid, beating the washing liquid in the reaction plate to be dry on the absorbent paper, quickly adding 100-200 mu L of sealing liquid per hole, placing the reaction plate in an incubator at 37 â, and incubating for 2 h; and pouring the confining liquid, and spin-drying by a plate-throwing machine or beating the confining liquid on absorbent paper to obtain the reaction plate, wherein if the reaction plate is not used immediately, the reaction plate is placed in a sealed bag and is added with a drying bag to be stored at the temperature of 2-8 â, and the drying bag is required to be positioned at the bottom of the reaction plate and cannot contact with the holes of the reaction plate.
3. Adding a sample to be tested: the reaction plate was equilibrated to room temperature and removed from the sealed bag, 100ul of E9-6, E9-7, E9-8, E9-10, E9-12, E9-15 was added to each well at an initial concentration of 5000ng/ml, diluted 2-fold gradient to 0.3ng/ml, shaken on a micro shaker for 60 seconds to mix the liquids in the wells uniformly, placed in an incubator at 37 â and incubated for 1 hour, with no antibody added to the negative control.
4. Adding an enzyme-labeled conjugate: using a sample diluent at 1: 20000 Dilute the secondary antibody-HRP, carefully remove the plate, add 100. mu.L of diluted secondary antibody-HRP to each well, replace the plate and attach, shake on a micro-shaker for 60 seconds to mix the liquids in the wells uniformly, place in a 37 â incubator, incubate for 1 h.
5. Washing the plate: carefully remove the plate, wash the reaction plate with 1x washing solution six times, and finally dry the reaction plate on absorbent paper or dry the reaction plate by a plate-swinging machine.
6. Color development: and uniformly mixing the color development solution A and the color development solution B according to the volume ratio of 1:1 to obtain color development working solution, adding 100 mu L of the color development working solution into each hole, replacing the plates, sticking the plates, and reacting for 10 minutes at 37 â in a dark place.
7. Reading:
carefully uncovering the plate, adding 50 mu L of stop solution into each hole to stop the reaction, detecting with 450nm single wavelength of an enzyme-labeling instrument, and measuring the light absorption value of each hole. The data for each set of reactions are shown in table 2:
TABLE 2 Absorbance at 450nm Single wavelength for each antibody
The Elisa plates were coated with T7RNA polymerase, bound to T7RNA polymerase molecules coated on the plates with varying concentrations of E9-15 antibody, and bound antibodies were determined with HRP-labeled goat anti-mouse IgG Fc antibody. The results in FIG. 2 show that the E9-15 antibody can bind to prokaryotically expressed T7RNA polymerase and exhibit concentration dependence and saturability.
Sequence listing
<110> Nanjing Novozan Biotechnology GmbH
<120> monoclonal antibody of T7RNA polymerase and preparation method thereof
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 10
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Gly Phe Ser Leu Ser Thr Ser Gly Met Gly
1 5 10
<210> 2
<211> 7
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Ile Trp Trp Asp Asp Val Lys
1 5
<210> 3
<211> 13
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Phe Arg Ile Asp Gly Leu Tyr Tyr Tyr Ala Met Asp Tyr
1 5 10
<210> 4
<211> 11
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Gln Ser Leu Val His Ser Asn Gly Asn Thr Tyr
1 5 10
<210> 5
<211> 3
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Lys Val Ser
1
<210> 6
<211> 10
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 6
Ser Gln Ser Thr His Val Pro Pro Phe Thr
1 5 10
<210> 7
<211> 121
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 7
Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln
1 5 10 15
Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30
Gly Met Gly Val Gly Trp Ile Arg Arg Pro Ser Gly Lys Gly Leu Glu
35 40 45
Trp Leu Ala His Ile Trp Trp Asp Asp Val Lys Arg Tyr Asn Pro Ala
50 55 60
Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Ser Ser Gln Val
65 70 75 80
Phe Leu Lys Ile Ala Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr
85 90 95
Cys Phe Arg Ile Asp Gly Leu Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly
100 105 110
Gln Gly Thr Ser Val Thr Val Ser Ser
115 120
<210> 8
<211> 113
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 8
Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Arg Leu Gly
1 5 10 15
Asp Gln Ala Ser Ile Ser Cys Arg Ser Asn Gln Ser Leu Val His Ser
20 25 30
Asn Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Ser Gln Ser
85 90 95
Thr His Val Pro Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile
100 105 110
Lys
<210> 9
<211> 324
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 9
Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala
1 5 10 15
Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr
20 25 30
Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser
35 40 45
Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu
50 55 60
Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val
65 70 75 80
Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys
85 90 95
Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro
100 105 110
Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu
115 120 125
Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser
130 135 140
Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu
145 150 155 160
Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr
165 170 175
Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn
180 185 190
Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro
195 200 205
Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln
210 215 220
Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val
225 230 235 240
Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val
245 250 255
Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln
260 265 270
Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn
275 280 285
Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val
290 295 300
Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His
305 310 315 320
Ser Pro Gly Lys
<210> 10
<211> 107
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 10
Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu
1 5 10 15
Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe
20 25 30
Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg
35 40 45
Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser
50 55 60
Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu
65 70 75 80
Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser
85 90 95
Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys
100 105
<210> 11
<211> 883
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 11
Met Asn Thr Ile Asn Ile Ala Lys Asn Asp Phe Ser Asp Ile Glu Leu
1 5 10 15
Ala Ala Ile Pro Phe Asn Thr Leu Ala Asp His Tyr Gly Glu Arg Leu
20 25 30
Ala Arg Glu Gln Leu Ala Leu Glu His Glu Ser Tyr Glu Met Gly Glu
35 40 45
Ala Arg Phe Arg Lys Met Phe Glu Arg Gln Leu Lys Ala Gly Glu Val
50 55 60
Ala Asp Asn Ala Ala Ala Lys Pro Leu Ile Thr Thr Leu Leu Pro Lys
65 70 75 80
Met Ile Ala Arg Ile Asn Asp Trp Phe Glu Glu Val Lys Ala Lys Arg
85 90 95
Gly Lys Arg Pro Thr Ala Phe Gln Phe Leu Gln Glu Ile Lys Pro Glu
100 105 110
Ala Val Ala Tyr Ile Thr Ile Lys Thr Thr Leu Ala Cys Leu Thr Ser
115 120 125
Ala Asp Asn Thr Thr Val Gln Ala Val Ala Ser Ala Ile Gly Arg Ala
130 135 140
Ile Glu Asp Glu Ala Arg Phe Gly Arg Ile Arg Asp Leu Glu Ala Lys
145 150 155 160
His Phe Lys Lys Asn Val Glu Glu Gln Leu Asn Lys Arg Val Gly His
165 170 175
Val Tyr Lys Lys Ala Phe Met Gln Val Val Glu Ala Asp Met Leu Ser
180 185 190
Lys Gly Leu Leu Gly Gly Glu Ala Trp Ser Ser Trp His Lys Glu Asp
195 200 205
Ser Ile His Val Gly Val Arg Cys Ile Glu Met Leu Ile Glu Ser Thr
210 215 220
Gly Met Val Ser Leu His Arg Gln Asn Ala Gly Val Val Gly Gln Asp
225 230 235 240
Ser Glu Thr Ile Glu Leu Ala Pro Glu Tyr Ala Glu Ala Ile Ala Thr
245 250 255
Arg Ala Gly Ala Leu Ala Gly Ile Ser Pro Met Phe Gln Pro Cys Val
260 265 270
Val Pro Pro Lys Pro Trp Thr Gly Ile Thr Gly Gly Gly Tyr Trp Ala
275 280 285
Asn Gly Arg Arg Pro Leu Ala Leu Val Arg Thr His Ser Lys Lys Ala
290 295 300
Leu Met Arg Tyr Glu Asp Val Tyr Met Pro Glu Val Tyr Lys Ala Ile
305 310 315 320
Asn Ile Ala Gln Asn Thr Ala Trp Lys Ile Asn Lys Lys Val Leu Ala
325 330 335
Val Ala Asn Val Ile Thr Lys Trp Lys His Cys Pro Val Glu Asp Ile
340 345 350
Pro Ala Ile Glu Arg Glu Glu Leu Pro Met Lys Pro Glu Asp Ile Asp
355 360 365
Met Asn Pro Glu Ala Leu Thr Ala Trp Lys Arg Ala Ala Ala Ala Val
370 375 380
Tyr Arg Lys Asp Lys Ala Arg Lys Ser Arg Arg Ile Ser Leu Glu Phe
385 390 395 400
Met Leu Glu Gln Ala Asn Lys Phe Ala Asn His Lys Ala Ile Trp Phe
405 410 415
Pro Tyr Asn Met Asp Trp Arg Gly Arg Val Tyr Ala Val Ser Met Phe
420 425 430
Asn Pro Gln Gly Asn Asp Met Thr Lys Gly Leu Leu Thr Leu Ala Lys
435 440 445
Gly Lys Pro Ile Gly Lys Glu Gly Tyr Tyr Trp Leu Lys Ile His Gly
450 455 460
Ala Asn Cys Ala Gly Val Asp Lys Val Pro Phe Pro Glu Arg Ile Lys
465 470 475 480
Phe Ile Glu Glu Asn His Glu Asn Ile Met Ala Cys Ala Lys Ser Pro
485 490 495
Leu Glu Asn Thr Trp Trp Ala Glu Gln Asp Ser Pro Phe Cys Phe Leu
500 505 510
Ala Phe Cys Phe Glu Tyr Ala Gly Val Gln His His Gly Leu Ser Tyr
515 520 525
Asn Cys Ser Leu Pro Leu Ala Phe Asp Gly Ser Cys Ser Gly Ile Gln
530 535 540
His Phe Ser Ala Met Leu Arg Asp Glu Val Gly Gly Arg Ala Val Asn
545 550 555 560
Leu Leu Pro Ser Glu Thr Val Gln Asp Ile Tyr Gly Ile Val Ala Lys
565 570 575
Lys Val Asn Glu Ile Leu Gln Ala Asp Ala Ile Asn Gly Thr Asp Asn
580 585 590
Glu Val Val Thr Val Thr Asp Glu Asn Thr Gly Glu Ile Ser Glu Lys
595 600 605
Val Lys Leu Gly Thr Lys Ala Leu Ala Gly Gln Trp Leu Ala Tyr Gly
610 615 620
Val Thr Arg Ser Val Thr Lys Arg Ser Val Met Thr Leu Ala Tyr Gly
625 630 635 640
Ser Lys Glu Phe Gly Phe Arg Gln Gln Val Leu Glu Asp Thr Ile Gln
645 650 655
Pro Ala Ile Asp Ser Gly Lys Gly Leu Met Phe Thr Gln Pro Asn Gln
660 665 670
Ala Ala Gly Tyr Met Ala Lys Leu Ile Trp Glu Ser Val Ser Val Thr
675 680 685
Val Val Ala Ala Val Glu Ala Met Asn Trp Leu Lys Ser Ala Ala Lys
690 695 700
Leu Leu Ala Ala Glu Val Lys Asp Lys Lys Thr Gly Glu Ile Leu Arg
705 710 715 720
Lys Arg Cys Ala Val His Trp Val Thr Pro Asp Gly Phe Pro Val Trp
725 730 735
Gln Glu Tyr Lys Lys Pro Ile Gln Thr Arg Leu Asn Leu Met Phe Leu
740 745 750
Gly Gln Phe Arg Leu Gln Pro Thr Ile Asn Thr Asn Lys Asp Ser Glu
755 760 765
Ile Asp Ala His Lys Gln Glu Ser Gly Ile Ala Pro Asn Phe Val His
770 775 780
Ser Gln Asp Gly Ser His Leu Arg Lys Thr Val Val Trp Ala His Glu
785 790 795 800
Lys Tyr Gly Ile Glu Ser Phe Ala Leu Ile His Asp Ser Phe Gly Thr
805 810 815
Ile Pro Ala Asp Ala Ala Asn Leu Phe Lys Ala Val Arg Glu Thr Met
820 825 830
Val Asp Thr Tyr Glu Ser Cys Asp Val Leu Ala Asp Phe Tyr Asp Gln
835 840 845
Phe Ala Asp Gln Leu His Glu Ser Gln Leu Asp Lys Met Pro Ala Leu
850 855 860
Pro Ala Lys Gly Asn Leu Asn Leu Arg Asp Ile Leu Glu Ser Asp Phe
865 870 875 880
Ala Phe Ala
Claims (13)1. An isolated antibody or antigen-binding fragment thereof, comprising: (a) a heavy chain variable domain (VH) comprising: heavy chain complementarity determining region 1(HCDR1) of the amino acid sequence shown in SEQ ID NO. 1, HCDR2 of the amino acid sequence shown in SEQ ID NO. 2, and HCDR3 of the amino acid sequence shown in SEQ ID NO. 3; and (b) a light chain variable domain (VL) comprising: light chain complementarity determining region 1(LCDR1) of the amino acid sequence shown in SEQ ID NO. 4, LCDR2 of the amino acid sequence shown in SEQ ID NO. 5, and LCDR3 of the amino acid sequence shown in SEQ ID NO. 6; wherein the antibody or antigen-binding fragment thereof is capable of specifically binding to T7RNA polymerase, the T7RNA polymerase comprising the amino acid sequence set forth in SEQ ID NO. 11.
2. The isolated antibody or antigen-binding fragment thereof of claim 1, wherein the VH comprises the amino acid sequence set forth in SEQ ID No. 7 and the VL comprises the amino acid sequence set forth in SEQ ID No. 8.
3. The isolated antibody or antigen-binding fragment thereof of any one of claims 1 or 2, further comprising a heavy chain constant domain (CH) of the amino acid sequence set forth in SEQ ID NO. 9 and a light chain constant domain (CL) of the amino acid sequence set forth in SEQ ID NO. 10.
4. The isolated antibody or antigen-binding fragment thereof of claim 1 or 2, which is rodent, chimeric, or fully humanized.
5. The isolated antibody or antigen-binding fragment thereof of claim 1 or 2, which is murine.
6. A nucleic acid encoding the isolated antibody or antigen-binding fragment thereof of any one of claims 1-5.
7. A vector comprising the nucleic acid of claim 6.
8. A host cell comprising the vector of claim 7.
9. A kit comprising the isolated antibody or antigen-binding fragment thereof of claim 1 and comprising a second isolated antibody or antigen-binding fragment thereof capable of binding the T7RNA polymerase of claim 1; wherein the second isolated antibody or antigen binding fragment thereof is capable of binding to a different epitope of the T7RNA polymerase than the isolated antibody or antigen binding fragment thereof of claim 1.
10. A kit comprising the isolated antibody or antigen-binding fragment thereof of claim 1 and comprising a second isolated antibody or antigen-binding fragment thereof capable of binding the T7RNA polymerase of claim 1; wherein the second isolated antibody or antigen-binding fragment thereof binds the T7RNA polymerase noncompetitively to the isolated antibody or antigen-binding fragment thereof of claim 1.
11. A method for detecting T7RNA polymerase remnants during mRNA vaccine preparation, the method comprising detecting T7RNA polymerase remnants using the isolated antibody or antigen-binding fragment thereof of claim 1 or 2, the kit of claim 9 or 10.
12. Use of the isolated antibody or antigen-binding fragment thereof of claim 1 or 2, the kit of claim 9 or 10, in the manufacture of an mRNA vaccine.
13. Use of the kit of claim 9 or 10 in an enzyme-linked immune reaction.
CN202111560797.7A 2021-12-20 2021-12-20 Monoclonal antibody of T7RNA polymerase and preparation method thereof Active CN114230666B (en) Priority Applications (1) Application Number Priority Date Filing Date Title CN202111560797.7A CN114230666B (en) 2021-12-20 2021-12-20 Monoclonal antibody of T7RNA polymerase and preparation method thereof Applications Claiming Priority (1) Application Number Priority Date Filing Date Title CN202111560797.7A CN114230666B (en) 2021-12-20 2021-12-20 Monoclonal antibody of T7RNA polymerase and preparation method thereof Publications (2) Family ID=80759072 Family Applications (1) Application Number Title Priority Date Filing Date CN202111560797.7A Active CN114230666B (en) 2021-12-20 2021-12-20 Monoclonal antibody of T7RNA polymerase and preparation method thereof Country Status (1) Families Citing this family (1) * Cited by examiner, â Cited by third party Publication number Priority date Publication date Assignee Title CN115219719A (en) * 2022-05-27 2022-10-21 æ±èè°±æ°çç©å»è¯æéå ¬å¸ T7 RNA Polymerase detection kit and method of use Citations (11) * Cited by examiner, â Cited by third party Publication number Priority date Publication date Assignee Title CN102395603A (en) * 2008-12-26 2012-03-28 å½ç«å¤§å¦æ³äººä¸äº¬å¤§å¦ Diagnosis and treatment of cancer using anti-lgr7 antibody JP2015232005A (en) * 2005-03-25 2015-12-24 ã¸ã¼ã¢ã¤ãã£ã¼ã¢ã¼ã«, ã¤ã³ã¯.GITR, Inc. Gitr binding molecule and use therefor AU2015221388A1 (en) * 2014-02-19 2016-08-04 Emergent Biosolutions Canada Inc. Methods of modulating an immune response CN107106683A (en) * 2015-01-16 2017-08-29 ä¸å¤®ç ç©¶é¢ Molecular construct comprising targeting and effector components CN107787330A (en) * 2015-04-07 2018-03-09 å¤å°äººç±»éä¼ æ§æ²»çå ¬å¸ For treating the antibody of anti-FLT 1 of Du Shi muscular dystrophy WO2018073725A1 (en) * 2016-10-17 2018-04-26 Linnane Pharma Ab Inhibitor of rna polymerase ii CN108136015A (en) * 2015-08-20 2018-06-08 è¾ä¼¯ç»´æ½ç¹å§æ£®ç¹å æ¯æéè´£ä»»å ¬å¸ Anti- DLL3 antibody drug conjugates and application method CN109207451A (en) * 2018-09-11 2019-01-15 天津å¸æ¹æ»¨çå¤åºå ç§å¦åå±æéå ¬å¸ DHA kinases/FMN cyclase mutain of people a kind of and its application CN111690626A (en) * 2020-07-02 2020-09-22 å京诺å¯èµçç©ç§æè¡ä»½æéå ¬å¸ Fusion type Taq DNA polymerase and preparation method and application thereof CN112368021A (en) * 2018-06-14 2021-02-12 èé¸çç©å ¬å¸ CD79A chimeric antigen receptor ES2832711T3 (en) * 2014-10-31 2021-06-11 Abbvie Biotherapeutics Inc Anti-CS1 Antibodies and Antibody Drug ConjugatesRetroSearch is an open source project built by @garambo | Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4