This document references all regular string_magic
operations. They can be used within string_magic
or can be accessed from string_ops
or string_clean
.
By default the function string_magic
returns a plain character vector. In this vignette it is sometimes nicer to apply the function base::cat
to display string_magic
results containing newlines. Ths function cat_magic
does exactly that and we will use it from time to time.
This section describes some of the most common string operations: extracting, replacing, collapsing, splitting, etc. Because they are so common, many of these operations have a one letter alias. These functions accept regex flags in their patterns. For more information on regex flags, see the dedicated section.
s
, S
, split
, Split
: Split strings
Splits the string according to a pattern. The four operations have different defaults: ' '
for s
and split
, and ',[ \t\n]*'
for S
and Split
(i.e. comma separation).
When character strings are split, their identity is kept in memory so that group-wise operations can be applied. See the section on group-wise operations.
# 'Split' with its default (comma separation)
string_magic("{Split ! romeo, juliet}")
#> [1] "romeo" "juliet"
# result with 's' is different
string_magic("{split ! romeo, juliet}")
#> [1] "romeo," "juliet"
# with argument: 's' and 'S' are identical
# note the flag 'fixed' (`f/`) to remove regex interpretation
string_magic("{'f/+'split, '-'collapse ! 5 + 2} = 3")
#> [1] "5 - 2 = 3"
# group wise operations (here `~(sort, collapse)`, see dedicated section)
prince_talk = c("O that this too too solid flesh would melt",
"Thaw, and resolve itself into a dew!",
"Or that the Everlasting had not fix'd",
"His canon 'gainst self-slaughter!")
cat_magic("Order matters:\n{split, ~(sort, collapse), align.center, lower, upper.sentence,
Q, '\n'collapse ? prince_talk}")
#> Order matters:
#> "Flesh melt o solid that this too too would"
#> " A and dew! Into itself resolve thaw, "
#> " Everlasting fix'd had not or that the "
#> " 'gainst canon his self-slaughter! "
c
, C
, collapse
, Collapse
: Collapse strings
To collapse (or concatenate) multiple strings into a single one. The four operations are identical, only their defaults change. The default is ' '
for c
and collapse
, and ', | and '
for C
and Collapse
. The syntax of the argument is 's1'
or 's1|s2'
. s1
is the string used to concatenate (think paste(x, collapse = s1)
). In arguments of the form 's1|s2'
, s2
will be used to concatenate the last two elements.
# regular way
x = 1:4
string_magic("And {' and 'collapse ? x}!")
#> [1] "And 1 and 2 and 3 and 4!"
# with s2
string_magic("Choose: {', | or 'collapse ? 2:4}?")
#> [1] "Choose: 2, 3 or 4?"
# default of Collapse: enumeration (similar to operation enum)
wines = c("Saint-Estephe", "Margaux")
string_magic("I like {Collapse ? wines}.")
#> [1] "I like Saint-Estephe and Margaux."
# default of collapse: space concatenation
string_magic("{split, '.{5,}'get, collapse ! I don't like short words}")
#> [1] "don't short words"
Extracts the first or multiple patterns from a string. Default argument is '[[:alnum:]]+'
. Command "extract"
accepts the option "first"
, and "x"
and "X"
accept no option. x
is an alias for extract.first
and X
for extract
. Use the option "first"
to extract only the first match for each string.
When patterns are extracted, the identity of each original character string is kept in memory so that group-wise operations can be applied. See the section on group-wise operations.
x = c("margo: 32, 1m75", "luke doe: 27, 1m71")
string_magic("{'^\\w+'extract ? x} is {'\\d+'extract.first ? x}")
#> [1] "margo is 32" "luke is 27"
# illustrating multiple extractions
# group-wise operation (~()) is detailed in its own section
x = c("Combien de marins, combien de capitaines.",
"Qui sont partis joyeux pour des courses lointaines,",
"Dans ce morne horizon se sont évanouis !")
string_magic("Endings with i: {'i\\w*'extract, ~(', 'collapse), enum.1 ? x}.")
#> [1] "Endings with i: 1) ien, ins, ien, itaines, 2) i, is, intaines, and 3) izon, is."
x = c("6 feet under", "mahogany")
# single extraction
string_magic("{'\\w{3}'x ? x}")
#> [1] "fee" "mah"
# multiple extraction
string_magic("{'\\w{3}'X ? x}")
#> [1] "fee" "und" "mah" "oga"
r
, R
, replace
: Replace patterns
Replaces a pattern with a string. The three operators r
, R
and replace
are identical and have no default. The syntax is 'flags/old'
or 'old => new'
with 'old'
the pattern to find and new
the replacement. flags/
are optional regex flags. The default for new
is the empty string. On top of regular regex flags, this operation also accepts the flags "total"
and single
. total
instructs to replace the fulll string in case the pattern is found.
The flag "single"
leads to only a single substitution per string (the first pattern is replaced). That is, the function base::sub
is used instead of base::gsub
.
# regex without replacement (ie removing)
string_magic("{'e'replace ! Where is the letter e?}")
#> [1] "Whr is th lttr ?"
# regex with replacement
string_magic("{'(?<!\\b)e => a'replace ! Where is the letter e?}")
#> [1] "Whara is tha lattar e?"
# with option "single"
string_magic("{'single/(?<!\\b)e => a'replace ! Where is the letter e?}")
#> [1] "Whare is the letter e?"
# we replace the full string with the flag total (`t/`)
x = c("Where is the letter e?", "Not this way!")
string_magic("{'total/e => here!'r ? x}")
#> [1] "here!" "Not this way!"
clean
: Clean string patterns
Replaces a pattern with a string. Similar to the operation r
, except that here the comma is a pattern separator. The argument is of the form "flags/pattern1, pattern2 => replacement"
. See detailed explanations in string_clean()
.
# we use the fixed pattern to remove the regex meaning
string_magic("{'f/[, ]'clean ! x[a]}")
#> [1] "xa"
get
: Get selected strings
Restricts the string vector to only the values respecting a pattern. This operation has no default. Accepts the options "equal"
and "in"
. By default it uses the same syntax as string_get()
so that you can use regex flags and include logical operations between regex patterns with ' & '
and ' | '
. If the option "equal"
is used, a simple string equality with the argument is tested (hence no flags are accepted). If the option "in"
is used, the argument is first split with respect to commas and then set inclusion is tested.
x = row.names(mtcars)
# we only keep models containing "Merc" and ending with a letter ([[:alpha:]]$)
string_magic("Mercedes models: {'Merc & [[:alpha:]]$'get, '^.+ 'r, enum ? x}.")
#> [1] "Mercedes models: 240D, 280C, 450SE, 450SL and 450SLC."
models = c("Merc 230", "Merc 450SE", "Merc 480")
# we only ekep the ones in the set
string_magic("Mercedes models: {`models`get.in, enum ? x}.")
#> [1] "Mercedes models: Merc 230 and Merc 450SE."
is
: Detect patterns in strings
Detects if a pattern is present in a string, returns a logical vector. This operation has no default. Mostly useful as the final operation in a string_ops()
call. By default it uses the same syntax as string_is()
so that you can use regex flags and include logical operations between regex patterns with ' & '
and ' | '
. If the option "equal"
is used, a simple string equality with the argument is tested (hence no flags are accepted). If the option "in"
is used, the argument is first split with respect to commas and then set inclusion is tested.
x = c("Mark", "Lucas")
# note that we use the flag `i/` to ignore the case
string_magic("Mark? {'i/mark'is, enum ? x}")
#> [1] "Mark? TRUE and FALSE"
which
: Get the index of the strings containing a pattern
Returns the index of string containing a specified pattern. With no default, can be applied to a logical vector directly. By default it uses the same syntax as string_which()
so that you can use regex flags and include logical operations between regex patterns with ' & '
and ' | '
. If the option "equal"
is used, a simple string equality with the argument is tested (hence no flags are accepted). If the option "in"
is used, the argument is first split with respect to commas and then set inclusion is tested. Mostly useful as the final operation in a string_ops()
call.
x = c("Mark", "Lucas", "Markus")
# note that we use the flag `i` to ignore the case and `w` to add word boundaries
string_magic("Mark is number {'iw/mark'which ? x}.")
#> [1] "Mark is number 1."
Operations changing the length or the order first
: Keep only the first elements
Keeps only the first n
elements.
string_magic("First 3 mpg values: {3 first, enum ? mtcars$mpg}.")
#> [1] "First 3 mpg values: 21, 21 and 22.8."
# you could have done the same with regular R in the expression...
string_magic("First 3 mpg values: {enum ? head(mtcars$mpg, 3)}.")
#> [1] "First 3 mpg values: 21, 21 and 22.8."
# ...but not in the middle of an operations chain
string_magic("First 3 integer mpg values: {'f/!.'get, 3 first, enum ? mtcars$mpg}.")
#> [1] "First 3 integer mpg values: 21, 21 and 26."
Negative numbers as argument remove the enum first n
values. You can add a second argument in the form 'n1|n2'first
in which case the first n1
and last n2
values are kept; n1
and n2
must be positive numbers.
string_magic("Letters in the middle: {13 first, 5 last, enum ? letters}.")
#> [1] "Letters in the middle: i, j, k, l and m."
string_magic("First and last letters: {'3|3'first, enum ? letters}.")
#> [1] "First and last letters: a, b, c, x, y and z."
string_magic("Last letters: {-21 first, enum ? letters}.")
#> [1] "Last letters: v, w, x, y and z."
K
: Keep only the first elements (alternative)
Keeps only the first n
elements; has more options than first
. The syntax is 'n'K
, 'n|s'K
, 'n||s'K
. n
provides the number of elements to keep. If s
is provided and the number of elements are greater than n
, then in 'n|s'
the string s
is added at the end, and if 'n||s'
the string s
replaces the nth element. The string s
accepts specials values: + :n:
or :N:
which gives the total number of items in digits or letters (N) + :rest:
or :REST:
which gives the number of elements that have been truncated in digits or letters (REST)
# basic use
string_magic("First 3 letters: {'3'K, q, enum ? letters}.")
#> [1] "First 3 letters: 'a', 'b' and 'c'."
# advanced use: using the extra argument
string_magic("The letters are: {q, '3|:rest: others'K, enum ? letters}.")
#> [1] "The letters are: 'a', 'b', 'c' and 23 others."
last
: Keep only the last elements
Keeps only the last n
elements. Negative numbers as argument remove the last n
values.
string_magic("Last 3 mpg values: {3 last, enum ? mtcars$mpg}.")
#> [1] "Last 3 mpg values: 19.7, 15 and 21.4."
string_magic("Removing the 3 last elements leads to {-3 last, enum ! x{1:5}}.")
#> [1] "Removing the 3 last elements leads to x1 and x2."
sort
: Sort the vector
Sorts the vector in increasing order. Accepts an optional argument and the option "num"
.
x = c("sort", "me")
# basic use
string_magic("{sort, collapse ? x}")
#> [1] "me sort"
If an argument is provided, it must be a regex pattern that will be applied to the vector using string_clean()
. The sorting will be applied to the modified version of the vector and the original vector will be ordered according to this sorting.
# first modifying the string before sorting
# here the regex first removes the first word, meaning that we sort on the last names
x = c("Jon Snow", "Khal Drogo")
string_magic("{'.+ 'sort, enum?x}")
#> [1] "Khal Drogo and Jon Snow"
The option "num"
sorts over a numeric version (with silent conversion) of the vector and reorders the original vector accordingly. Values which could not be converted are last.
x = "Mark is 34, Bianca is 55, Odette is 101, Julie is 21 and Frank is 5"
# sort on the "character string" number
string_magic("{', | and 'split, '\\D'sort, enum ? x}")
#> [1] "Odette is 101, Julie is 21, Mark is 34, Frank is 5 and Bianca is 55"
# we extract the numbers, then convert to numeric, then sort
string_magic("{', | and 'split, '\\D'sort.num, enum ? x}")
#> [1] "Frank is 5, Julie is 21, Mark is 34, Bianca is 55 and Odette is 101"
Important note: the sorting operation is applied before any character conversion. If previous operations were applied, it is likely that numeric data were transformed to character.
# note the difference
x = c(20, 100, 10)
# sorting on numeric
string_magic("{sort, ' + 'collapse ? x}")
#> [1] "10 + 20 + 100"
# sorting on character since 'n' operation transformed the vector to character
string_magic("{n, sort, ' + 'collapse ? x}")
#> [1] "10 + 100 + 20"
dsort
: Sort the vector in decreasing order
Sorts the vector in decreasing order. It accepts an optional argument and the option "num"
. See the operation "sort"
for a description of the argument and the option.
string_magic("5 = {dsort, ' + 'collapse ? 2:3}")
#> [1] "5 = 3 + 2"
rev
: Reverse the vector
Reverses the vector.
unik
: Keep only unique elements
Makes the string vector unique.
string_magic("Iris species: {unik, upper.first, enum ? iris$Species}.")
#> [1] "Iris species: Setosa, Versicolor and Virginica."
table
: Attach unique elements to their frequencies
Computes the frequency of each element and attaches each element to its frequency. Accepts an argument which must be a character string representing a string_magic
interpolation with the following variables: x
(the element), n
(its count) and s
(its share). The default argument is '{x} ({n ? n})'
.
By default the resulting string vector is sorted by decreasing frequency. You can change how the vector is sorted with five options: sort
(sorts on the elements), dsort
(decreasing sort), fsort
(sorts on frequency), dfsort
(decreasing sort on freq. – default), nosort
(keeps the order of the first elements). Note that you can combine several sorts (to resolve the ties of elements with same frequencies).
dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "")
cat_magic("Letters in the DNA seq. {''c, Q? dna}: ",
" - default: {table, enum ? dna}",
" - value sorted: {table.sort, enum ? dna}",
" - shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}",
# `fsort` sorts by **increasing** frequency
" - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}",
.sep = "\n")
#> Letters in the DNA seq. "atagggagctacctgcgcgtcgcccaaaagcaggg":
#> - default: g (12), c (10), a (9) and t (4)
#> - value sorted: a (9), c (10), g (12) and t (4)
#> - shares: g [34%], c [29%], a [26%] and t [11%]
#> - freq. sorted: 't', 'a', 'c' and 'g'
each
: Repeat each elements of the vector
Repeats each element of the vector n
times. Option "c"
then collapses the full vector with the empty string as a separator.
# note: operation `S` splits splits wrt to commas (default behavior)
string_magic("{S!x, y}{2 each ? 1:2}")
#> [1] "x1" "y1" "x2" "y2"
# illustrating collapsing
string_magic("Large number: 1{5 each.c ! 0}")
#> [1] "Large number: 100000"
times
: Repeats the vector
Repeats the vector sequence n
times. Option "c"
then collapses the full vector with the empty string as a separator.
rm
: Remove specific values
Removes elements from the vector. Options: "empty"
, "blank"
, "noalpha"
, "noalnum"
, "all"
. The optional argument represents the pattern used to detect strings to be deleted.
x = c("Luke", "Charles")
string_magic("{'i/lu'rm ? x}")
#> [1] "Charles"
By default it removes empty strings. Option "blank"
removes strings containing only blank characters (spaces, tab, newline). Option "noalpha"
removes strings not containing letters. Option "noalnum"
removes strings not containing alpha numeric characters. Option "all"
removes all strings (useful in conditions, see the dedicated section). If an argument is provided, only the options "empty"
and "blank"
are available.
x = c("I want to enter.", "Age?", "21.")
string_magic("Nightclub conversation: {rm.noalpha, c ! - {x}}")
#> [1] "Nightclub conversation: - I want to enter. - Age?"
nuke
: Remove all value
Removes all elements, equivalent to rm.all
but possibly more explicit. Useful in conditions, see the dedicated section.
x = c(5, 7, 453, 647)
# here we use a condition: see the dedicated section for more information
string_magic("Small numbers only: {if(.>20 ; nuke), enum ? x}.")
#> [1] "Small numbers only: 5 and 7."
insert
: Insert a character string
Inserts a new element to the vector. Options: "right"
and "both"
. Option "right"
adds the new element to the right. Option "both"
inserts the new element on the two sides of the vector.
string_magic("{'3'insert.right, ' + 'collapse ? 1:2}")
#> [1] "1 + 2 + 3"
dp
, deparse
: Deparse an object
Deparses an object and keeps only the first characters of the deparsed string. Accepts a number as argument. In that case only the first n
characters are kept. Accepts option long
: in that case all the lines of the deparsed object are first collapsed.
fml = y ~ x1 + x2
string_magic("The estimated model is {dp ? fml}.")
#> [1] "The estimated model is y ~ x1 + x2."
string_magic("The estimated model is {10 dp ? fml}.")
#> [1] "The estimated model is y ~ x1 +...."
Formatting operations lower
: Change the case
Lower cases the full string.
x = "MesSeD uP CaSe"
string_magic("from a {x} to {lower?x}")
#> [1] "from a MesSeD uP CaSe to messed up case"
upper
: Change the case
Upper cases the full string. Options: "first"
and "sentence"
. Option "first"
upper cases only the first character. Option "sentence"
upper cases the first letter after punctuation.
x = "hi. how are you? fine."
string_magic("{upper.sentence ? x}")
#> [1] "Hi. How are you? Fine."
title
: Change the case
Applies a title case to the string. Options: "force"
and "ignore"
. Option "force"
first puts everything to lowercase before applying the title case. Option "ignore"
ignores a few small prepositions (“a”, “the”, “of”, etc).
x = "bryan is in the KITCHEN"
# default: respects upper cases
string_magic("{title ? x}")
#> [1] "Bryan Is In The KITCHEN"
# force: force to title case
string_magic("{title.force ? x}")
#> [1] "Bryan Is In The Kitchen"
# ignore: ignores small prepositions
string_magic("{title.force.ignore ? x}")
#> [1] "Bryan Is in the Kitchen"
ws
: Normalize white spaces
Normalizes whitespaces (WS). It trims the whitespaces on the edges and transforms any succession of whitespaces into a single one. Can also be used to further clean the string with its options. Options: "punct"
, "digit"
, "isolated"
. Option "punct"
cleans the punctuation. Option "digit"
cleans digits. Option "isolated"
cleans isolated letters. WS normalization always come after any of these options. Important note: punctuation (or digits) are replaced with WS and not the empty string. This means that string_magic("ws.punct ! Meg's car")
will become "Meg s car"
.
x = " I should? review 85 4 this text!!"
cat_magic("v0: {x}",
"v1: {ws ? x}",
"v2: {ws.punct ? x}",
"v3: {ws.punct.digit ? x}",
"v4: {ws.punct.digit.isolated ? x}", .sep = "\n")
#> v0: I should? review 85 4 this text!!
#> v1: I should? review 85 4 this text!!
#> v2: I should review 85 4 this text
#> v3: I should review this text
#> v4: should review this text
tws
: Trim white spaces
Trims the white spaces on both ends of the strings.
x = " too much space \t\n"
string_magic("With trim: {tws, Q ? x}")
#> [1] "With trim: \"too much space\""
q
, Q
, bq
: Add various type of quotes
To add quotes to the strings. q: single quotes, Q: double quotes, bq: back quotes.
x = c("Mark", "Pam")
string_magic("Hello {q, enum ? x}!")
#> [1] "Hello 'Mark' and 'Pam'!"
format
, Format
: Format the values with base::format
Applies the base R’s function base::format()
to the string. By default, the values are left aligned, even numbers (differently from base::format()
’s behavior). The upper case command (Format
) applies right alignment. Options: "0"
, "left"
, "zero"
, "right"
, "center"
. Options "0"
or "zero"
fills the blanks with 0s: useful to format numbers. Option "right"
right aligns, and "center"
centers the strings.
x = c(1, 12345)
cat_magic("left : {format, q, enum ? x}",
"right : {Format, q, enum ? x}",
"center: {format.center, q, enum ? x}",
"zero : {format.0, q, enum ? x}", .sep = "\n")
#> left : '1 ' and '12,345'
#> right : ' 1' and '12,345'
#> center: ' 1 ' and '12,345'
#> zero : '000001' and '12,345'
%:
Apply sprintf
formatting
Applies base::sprintf()
formatting. The syntax is 'arg'%
with arg an sprintf formatting, or directly the sprint formatting.
stopwords
: Remove stop words
Removes basic English stopwords (the snowball list is used). The stopwords are replaced with an empty space but the left and right WS are untouched. So WS normalization may be needed (see operation ws
).
x = c("He is tall", "He isn't young")
string_magic("Is he {stop, ws, enum ? x}?")
#> [1] "Is he tall and young?"
ascii
: Turn the string to ASCII
Turns all letters into ASCII with transliteration. Failed translations are transformed into question marks. Options: "silent"
, "utf8"
. By default, if some conversion fails a warning is prompted. Option "silent"
disables the warning in case of failed conversion. The conversion is done with base::iconv()
, option "utf8"
indicates that the source endocing is UTF-8, can be useful in some cases.
author = "Laurent Bergé"
string_magic("This package has been developped by {ascii ? author}.")
#> [1] "This package has been developped by Laurent Berge."
n
, N
: Formatting integers
Formats integers by adding a comma to separate thousands. Options: "letter"
, "upper"
, "0"
, "zero"
, "roman"
, "Roman"
. The option "letter"
writes the number in letters (large numbers keep their numeric format). The option "upper"
is like the option "letter"
but uppercases the first letter. Options "0"
or "zero"
left pads numeric vectors with 0s. The options "roman"
and "Roman"
write the integer in Roman with utils::as.roman
. The lower case version writes them in lower case. The upper case command (N
) adds the option "letter"
.
x = c(5, 12, 52123)
string_magic("She owes {n, '$'paste, enum ? x}.")
#> [1] "She owes $5, $12 and $52,123."
# option 0: all same width, no ',' for thousands
cat_magic("|---|\n{n.0, '\n'collapse ? x}")
#> |---|
#> 00005
#> 00012
#> 52123
# option "upper"
n = 5
string_magic("{n.upper ? n} is my favourite number.")
#> [1] "Five is my favourite number."
# N: like "n.letter"
x = 5
string_magic("He's {N ? x} years old.")
#> [1] "He's five years old."
# roman
string_magic("What's nicer? {collapse?11:13}, {n.roman, c?11:13} or {n.Roman, c?11:13}?")
#> [1] "What's nicer? 11 12 13, xi xii xiii or XI XII XIII?"
nth
, Nth
: Numbered position
When applied to a number, this operator writes them as a rank. Options: "letter"
, "upper"
, "compact"
.
n = c(3, 7)
string_magic("They finished {nth, enum ? n}!")
#> [1] "They finished 3rd and 7th!"
Option "letter"
tries to write the numbers in letters, but note that it stops at 20. Option "upper"
is the same as "letter"
but uppercases the first letter. Option "compact"
aggregates consecutive sequences in the form "start_n_th to end_n_th"
.
string_magic("They arrived {nth.compact ? 5:20}.")
#> [1] "They arrived 5th to 20th."
The upper case command (Nth
) adds the option "letter"
.
n = c(3, 7)
string_magic("They finished {Nth, enum ? n}!")
#> [1] "They finished third and seventh!"
ntimes
, Ntimes
: Number of times
Write numbers in the form n
times. Options: "letter"
, "upper"
. Option "letter"
writes the number in letters (up to 100). Option "upper"
does the same as "letter"
and uppercases the first letter.
string_magic("They lost {enum ! {ntimes ? c(1, 12)} against {S!Real, Barcelona}}.")
#> [1] "They lost once against Real and 12 times against Barcelona."
The upper case command (Ntimes
) adds the option "letter"
.
x = 5
string_magic("This paper was rejected {Ntimes ? x}...")
#> [1] "This paper was rejected five times..."
firstchar
, lastchar
: Keep only the first, last characters
To select the first/last characters of each element. Negative numbers remove the first/last characters.
string_magic("{19 firstchar, 9 lastchar ! This is a very long sentence}")
#> [1] "very long"
string_magic("delete 3 = {-3 firstchar ! delete 3}")
#> [1] "delete 3 = ete 3"
k
, shorten
, Shorten
: Shortens character strings
To keep only the first n
characters (like firstchar
but with more options). (Note that k
stands for “keep” and exists for historical reasons.) Available options: "include"
, "dots"
. The argument can be of the form 'n'
or 'n|s'
with n
a number and s
a string. n
provides the number of characters to keep. Optionnaly, only for strings whose length is greater than n
, after truncation, the string s
is appended at the end.
By default, if argument s
is provided, strings longer than n
end up at size n + nchar(s)
. If option "include"
is provided, the strings are guaranteed to be of maximum size n
, even after the string s
has been appended. Example: if n=4
and s=".."
, then “hello” becomes “hell..” without "include"
, and “he..” with it.
Option "dots"
: if strings are longer than n+1
, they are truncated at n-1
and two dots are appended. For example if n = 3
, then “hello” becomes “he..”. Disregards the argument s
. The operation "Shorten"
(upper case), is with the option "dots"
.
Note that another way to add the option "include"
is to use a double pipe for the argument s
, like in 'n||s'
.
x = "long sentence"
cat_magic("v0: {x}",
"v1: {4 shorten ? x}",
"v2: {'4|..'shorten ? x}",
"v3: {'4|..'shorten.include ? x}",
"v4: {4 shorten.dots ? x}", .sep = "\n")
#> v0: long sentence
#> v1: long
#> v2: long..
#> v3: lo..
#> v4: lon..
fill
, align
, width
: Fill character strings
Fills the character strings up to a size in order to fit a given width. align
and width
are aliases to fill
. Options: "right"
or "center"
. Default is left-alignment of the strings.
The argument is optional and can be of the form 'n'
or 'n|s'
. By default if no argument is provided, of if n=0
,n
is equal to the maximum character length of the vector. The optional argument s
is a symbol used to fill the blanks. By default s
is equal to a white space.
Option "right"
right aligns and "center"
centers the strings.
See help for string_fill()
for more information.
life = "full of sound and fury, Signifying nothing"
cat_magic("{'[ ,]+'split, upper.first, fill.center, q, '\n'collapse ? life}")
#> ' Full '
#> ' Of '
#> ' Sound '
#> ' And '
#> ' Fury '
#> 'Signifying'
#> ' Nothing '
# fixing the length and filling with 0s
string_magic("{'5|0'fill.right, enum ? c(1, 55)}")
#> [1] "00001 and 00055"
paste
, append
: Append text
Pastes a custom character string to all elements of the string. The operations paste
and append
are equivalent. This operation has no default. Options: "left"
, "both"
, "right"
, "front"
, "back"
, "delete"
. By default, a string is pasted on the left. Option "right"
pastes on the right and "both"
pastes on both sides. Option "front"
only pastes on the first element while option "back"
only pastes on the last element. Option "delete"
first replaces all elements with the empty string.
string_magic("y = {'x'paste, ' + 'collapse ? 1:3}")
#> [1] "y = x1 + x2 + x3"
The argument can be of the form s1
or s1|s2
. If of the second form, this is equivalent to chaining two paste
operations, once on the left and once on the right: 's1'paste, 's2'paste.right
.
string_magic("y = {'x|0'paste, ' + 'collapse ? 1:3}")
#> [1] "y = x10 + x20 + x30"
join
: Join lines
Joins lines ending with a double backslash.
sun = "The sun \\
is shining."
string_magic("How is the sun? {join ? sun}")
#> [1] "How is the sun? The sun is shining."
escape
: Escape special characters
Adds backslashes in front of specific characters. Options "nl"
, "tab"
. Option "nl"
escapes the newlines (\n
), leading them to be displayed as "\\\\n"
. Option "tab"
does the same for tabs ("\t"
). This is useful to make the value free of space formatters. The default behavior is to escape both newlines and tabs.
input = "yes \n\n no"
msg = string_magic("Your input, equal to {escape, bq ? input} is incorrect.")
cat(msg, sep = "\n")
#> Your input, equal to `yes \n\n no` is incorrect.
Other operations num
: Convert to numeric
Converts to numeric. Options: "warn"
, "soft"
, "rm"
, "clear"
. By default, the conversion is performed silently and elements that fail to convert are turned into NA. Option "warn"
displays a warning if the conversion to numeric fails. Option "soft"
does not convert if the conversion of at least one element fails, leading to a character vector. Option "rm"
converts and removes the elements that could not be converted. Option "clear"
turns failed conversions into the empty string, and hence lead to a character vector.
x = c(5, "six")
cat_magic(" origin: {enum, q ? x}",
" num: {num, enum, q ? x}",
" num.rm: {num.rm, enum, q ? x}",
" num.soft: {num.soft, enum, q ? x}",
"num.clear: {num.clear, enum, q ? x}", .sep = "\n")
#> origin: '5 and six'
#> num: '5 and NA'
#> num.rm: '5'
#> num.soft: '5 and six'
#> num.clear: '5 and '
enum
: Create an enumeration
Enumerates the elements. It creates a single string containing the comma separated list of elements. If there are more than 7 elements, only the first 6 are shown and the number of items left is written.
You can add the following options:
q
, Q
, or bq
: to quote the elementsor
, nor
: to finish with an ‘or’ (or ‘nor’) instead of an ‘and’comma
: to finish the enumeration with “,” instead of “, and”.i
, I
, a
, A
, 1
: to enumerate with this prefix, like in: i) one, and ii) twox = c("Marv", "Nancy")
string_magic("The murderer must be {enum.or ? x}.")
#> [1] "The murderer must be Marv or Nancy."
x = c("oranges", "milk", "rice")
string_magic("Shopping list: {enum.i.q ? x}.")
#> [1] "Shopping list: i) 'oranges', ii) 'milk', and iii) 'rice'."
# enum is made for display: when vectors are too long, they are truncated
# default is at 7
x = string_magic("x{sample(100, 30)}")
string_magic("The problematic variables are {'x'sort.num, enum ? x}.")
#> [1] "The problematic variables are x2, x4, x5, x7, x23, x24 and 24 others."
# you can augment or reduce the numbers to display with an option
string_magic("The problematic variables are {'x'sort.num, enum.3 ? x}.")
#> [1] "The problematic variables are x2, x4 and 28 others."
len
, Len
: Formatted length
Gives the length of the vector. Options "letter"
, "upper"
, "num"
. Option "letter"
writes the length in words (up to 100). Option "upper"
is the same as letter but uppercases the first letter. By default, the number is formatted: commas are inserted to separate thousands.
cat_magic("The length of 1:5000:",
" - len = {len ? 1:5000}",
" - len.num = {len.num ? 1:5000}", .sep = " \n")
#> The length of 1:5000:
#> - len = 5,000
#> - len.num = 5000
The upper case command (Len
) adds the option "letter"
(only for small numbers).
string_magic("Its size is {Len ? 1:8}")
#> [1] "Its size is eight"
swidth
: Add newlines to force the string to fit a given width
Thie operation stands for “screen width”. It formats the string to fit a given width by cutting at word boundaries and adding newlines appropriately. Accepts arguments of the form 'n'
or 'n|s'
, with n
a number and s
a string. An argument of the form 'n|s'
will add s
at the beginning of each line. Further, by default a trailing white space is added to s
; to remove this behavior, add an underscore at the end of it. The argument n
is either an integer giving the target character width (minimum is 15), or it can be a fraction expressing the target size as a fraction of the current screen. Finally it can be an expression that uses the variable .sw
which will capture the value of the current screen width.
x = "this is a long sentence"
cat_magic("------ version 0 ------\n{x}",
"------ version 1 ------\n{15 swidth ? x}",
"------ version 2 ------\n{'15|#>'swidth ? x}",
"------ version 3 ------\n{'15|#>_'swidth ? x}", .sep = "\n")
#> ------ version 0 ------
#> this is a long sentence
#> ------ version 1 ------
#> this is a long
#> sentence
#> ------ version 2 ------
#> #> this is a
#> #> long
#> #> sentence
#> ------ version 3 ------
#> #>this is a
#> #>long sentence
difftime
: Formatted time difference
Displays a formatted time difference. Option "silent"
does not report a warning if the operation fails. It accepts either objects of class POSIXt
or difftime
.
RetroSearch is an open source project built by @garambo | Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4