Hello. I am attempting to integrate two merged objects, one sci-atac the other snRNA, and having an issue while calculating gene activity. Despite the error it appears the chromosomes in the frag files are consistent with the annotations. Not sure if I need to merge fragment files for the atac component as in the 0.2.5 signac merging vignette. It seems that method was phased out. Any advice would be appreciated. Thanks!
Here is the code and traceback.
gene.activities <- GeneActivity(atac.sobj, features = VariableFeatures(atac.sobj))
1. GeneActivity(atac.sobj, features = VariableFeatures(atac.sobj))
2. FeatureMatrix(fragments = frags, features = transcripts, cells = cells,
. verbose = verbose, ...)
3. sapply(X = obj.use, FUN = function(x) {
. SingleFeatureMatrix(fragment = fragments[[x]], features = features,
. cells = cells, sep = sep, verbose = verbose, process_n = process_n)
. })
4. lapply(X = X, FUN = FUN, ...)
5. FUN(X[[i]], ...)
6. SingleFeatureMatrix(fragment = fragments[[x]], features = features,
. cells = cells, sep = sep, verbose = verbose, process_n = process_n)
7. stop("No matching chromosomes found in fragment file.")
Here are samples of the annotation and fragments.
Annotation:
GRanges object with 6 ranges and 5 metadata columns:
seqnames ranges strand | tx_id
|
ENSMUSE00001236884 chr3 3508030-3508332 + | ENSMUST00000108393
ENSMUSE00000676606 chr3 3634150-3634347 + | ENSMUST00000108394
ENSMUSE00001345708 chr3 3638059-3638230 + | ENSMUST00000108393
ENSMUSE00001345708 chr3 3638059-3638230 + | ENSMUST00000108394
ENSMUSE00000149313 chr3 3641223-3641317 + | ENSMUST00000108393
ENSMUSE00000149313 chr3 3641223-3641317 + | ENSMUST00000108394
gene_name gene_id gene_biotype type
ENSMUSE00001236884 Hnf4g ENSMUSG00000017688 protein_coding exon
ENSMUSE00000676606 Hnf4g ENSMUSG00000017688 protein_coding exon
ENSMUSE00001345708 Hnf4g ENSMUSG00000017688 protein_coding exon
ENSMUSE00001345708 Hnf4g ENSMUSG00000017688 protein_coding exon
ENSMUSE00000149313 Hnf4g ENSMUSG00000017688 protein_coding exon
ENSMUSE00000149313 Hnf4g ENSMUSG00000017688 protein_coding exon
seqinfo: 22 sequences from mm10 genome
Fragment object (one of six present in merged atac object):
chrom start end barcode readCount
chr1 3000826 3000898 LL_7_TACTTTGCGCAAAGGAACAGAC 1
chr1 3001689 3001808 LL_7_CCTATGTGTAACCGTCCCATTC 1
chr1 3001738 3001792 LL_7_GGATTGCCTTCTTAGGTAGCGT 1
chr1 3001738 3001956 LL_7_GCCAACTGAGGGTTGTCCTCTG 1
chr1 3003199 3003367 LL_7_ACTCCTATGGAAATAAGGCCAG 1
chr1 3003574 3003641 LL_7_CAACCTCATTTGACACTGTGCG 1
Our OS is CentOS. Here is the session info:
R version 4.1.0 (2021-05-18)
Platform: x86_64-conda-linux-gnu (64-bit)
Running under: CentOS Linux 7 (Core)
Matrix products: default
BLAS/LAPACK: /home/rlancione/miniconda3/envs/renv4/lib/libopenblasp-r0.3.15.so
locale:
[1] C
attached base packages:
[1] parallel stats4 stats graphics grDevices utils datasets
[8] methods base
other attached packages:
[1] EnsDb.Mmusculus.v79_2.99.0 ensembldb_2.16.4
[3] AnnotationFilter_1.16.0 GenomicFeatures_1.44.0
[5] AnnotationDbi_1.54.1 Biobase_2.52.0
[7] Matrix_1.3-4 gridExtra_2.3
[9] ggplot2_3.3.5 dplyr_1.0.7
[11] GenomicRanges_1.44.0 GenomeInfoDb_1.28.1
[13] IRanges_2.26.0 S4Vectors_0.30.0
[15] BiocGenerics_0.38.0 Signac_1.3.0
[17] SeuratObject_4.0.2 Seurat_4.0.3
RetroSearch is an open source project built by @garambo | Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4