Showing content from https://gist.github.com/Zulko/f9aa781aaaab2c4d66ccd968ca85ca1d below:
Makes a GIF showing DNA Chisel's algorithm in action ยท GitHub
# Warning: quick and dirty code. import dnachisel as dc import proglog proglog.notebook() import matplotlib.pyplot as plt from dna_features_viewer import BiopythonTranslator, GraphicFeature counter = [0] def feature_key(f): return str(f.label).split(",")[0] def plot_problem(problem): fig, ax = plt.subplots(1, figsize=(12, 4)) default_props = dict(thickness=20, box_color=None, fontdict=dict(size=14, color="white", weight="bold")) rec = problem.to_record() translator = BiopythonTranslator(features_properties=lambda f: default_props) grec = translator.translate_record(rec) _, (levels, _) = grec.plot(annotate_inline=True, ax=ax, with_ruler=False) levels = {f.label: level for f, level in levels.items()} grec.plot_sequence(ax=ax, background=None) rec = problem.to_record() evals = problem.constraints_evaluations() rec.features = evals.locations_as_features(with_specifications=False) default_props = dict(label=None, color='#ff9999', linewidth=0) translator = BiopythonTranslator(features_properties=lambda f: default_props) grec = translator.translate_record(rec) grec.plot(ax=ax, with_ruler=False, level_offset=-1.5) ax.set_ylim((-2, 3)) for f in problem.sequence_edits_as_features(): ax.fill_between([f.location.start - 0.5, f.location.end-0.5], -0.5, -.9, facecolor="orange", alpha=0.15) fontdict = dict(weight="bold", size=12) ax.text(-1, 1, "Constraints", ha="right", va="center", fontdict=fontdict) ax.text(-1, -0.7, "Sequence", ha="right", va="center", fontdict=fontdict) ax.text(-1, -1.5, "Breaches", ha="right", va="center", fontdict=fontdict) return ax, levels def plot_stored(stored): location, problem, local_pb = (stored[f] for f in ("location", "problem", "local_problem")) local_rec = local_pb.to_record() evals = local_pb.constraints_evaluations() local_constraints_as_features = evals.success_and_failures_as_features() L = len(problem.sequence) ax, levels = plot_problem(problem) start, end = location.start - 0.5, location.end - 0.5 fog_start = min(f.location.start for f in local_rec.features) - 0.5 fog_end = max(f.location.end for f in local_rec.features) - 0.5 ax.fill_between([-1, fog_start], -.3, 3, facecolor="white", alpha=0.8) ax.fill_between([fog_end, L+1], -.3, 3, facecolor="white", alpha=0.8) for x in fog_start, fog_end: ax.axvline(x, ls=":", c="grey") if (counter[0] + 1) % 2: for x in start, end: ax.axvline(x, ls="--", ymin=0.05, ymax=0.31, c="grey") ax.fill_between([start, end], -0.5, -.9, facecolor="orange", alpha=0.5) default_props = dict(label=None, color='#99ff99', linewidth=1) translator = BiopythonTranslator(features_properties=lambda f: default_props) grec = translator.translate_record(local_rec) for f in local_constraints_as_features: color = "#77dd77" if (f.qualifiers["passes"] == "true") else "#dd7777" label = f.qualifiers["label"] gf = GraphicFeature(f.location.start, f.location.end, color=color, label=None, thickness=16) grec.plot_feature(ax, gf, level=levels[label]) return ax def plot_png(ax): ax.figure.savefig("./pics/captures/cap_%04d.png" % counter[0], dpi=300) ax.figure.savefig("./pics/captures_svg/cap_%04d.svg" % counter[0]) counter[0] += 1 plt.close(ax.figure) class CustomBarLogger(proglog.TqdmProgressBarLogger): def store_callback(self, **kw): if "local_problem" in kw: ax = plot_stored(self.stored) plot_png(ax) def bars_callback(self, bar, attr, value, old_value=None): if all([bar == "location", attr=="index", value==1 or value != self.bars[bar]["total"], self.stored]): ax = plot_stored(self.stored) plot_png(ax) seq = "AATGCTATGCGTCGTTTATGCAATGACATGCATGCGTCGTTTATCGAATGCA" problem = dc.DnaOptimizationProblem( seq, constraints = [dc.AvoidPattern("ATGC", location=(0, 31)), dc.AvoidPattern("CG", location=(10, 45)), dc.EnforceGCContent(mini=0.3, maxi=0.75, window=10, location=(15, 50)), ], logger = CustomBarLogger() ) ax, _ = plot_problem(problem) plot_png(ax) plot_png(ax) problem.resolve_constraints() import moviepy.editor as mpe def fl(gf, t): if int(t) % 2: return gf(t) p = (t % 1)**3 return p * gf(int(t+1)) + (1 - p) * gf(t) clip = (mpe.ImageSequenceClip("./pics/captures/", fps=1) .fl(fl) .fx(mpe.vfx.freeze, t="end", freeze_duration=3) .subclip(0 , -1)) clip.write_videofile("animation.mp4", fps=24)
RetroSearch is an open source project built by @garambo
| Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4