Filamentous fungi produce numerous natural products that constitute a consistent source of potential drug leads, yet it seems that the majority of natural products are overlooked since most biosynthesis gene clusters are silent under standard cultivation conditions. Screening secondary metabolite genes of the model fungus Aspergillus nidulans, we noted a silent gene cluster on chromosome II comprising two nonribosomal peptide synthetase (NRPS) genes, inpA and inpB, flanked by a regulatory gene that we named scpR for secondary metabolism cross-pathway regulator. The induced expression of the scpR gene using the promoter of the alcohol dehydrogenase AlcA led to the transcriptional activation of both the endogenous scpR gene and the NRPS genes. Surprisingly, metabolic profiling of the supernatant of mycelia overexpressing scpR revealed the production of the polyketide asperfuranone. Through transcriptome analysis we found that another silent secondary metabolite gene cluster located on chromosome VIII coding for asperfuranone biosynthesis was specifically induced. Quantitative reverse transcription-PCR proved the transcription not only of the corresponding polyketide synthase (PKS) biosynthesis genes, afoE and afoG, but also of their activator, afoA, under alcAp-scpR-inducing conditions. To exclude the possibility that the product of the inp cluster induced the asperfuranone gene cluster, a strain carrying a deletion of the NRPS gene inpB and, in addition, the alcAp-scpR overexpression cassette was generated. In this strain, under inducing conditions, transcripts of the biosynthesis genes of both the NRPS-containing gene cluster inp and the asperfuranone gene cluster except gene inpB were detected. Moreover, the existence of the polyketide product asperfuranone indicates that the transcription factor ScpR controls the expression of the asperfuranone biosynthesis gene cluster. This expression as well as the biosynthesis of asperfuranone was abolished after the deletion of the asperfuranone activator gene afoA, indicating that ScpR binds to the afoA promoter. To the best of our knowledge, this is the first report of regulatory cross talk between two biosynthesis gene clusters located on different chromosomes.
Fungi are prolific producers of low-molecular-weight molecules with various biological activities, such as antibiotic, immunosuppressive, and antitumor activities (5, 12, 15). However, bioinformatic analyses of the sequenced fungal genomes indicate that their potential to produce secondary metabolites is greatly underestimated, and it appears that many cryptic natural products await discovery (6, 9, 11). For example, mining the published Aspergillus nidulans genome sequence led to the identification of 53 putative secondary metabolite gene clusters (21). This number does not reflect the much lower number of secondary metabolites identified from the fungus, until today. Since most of the fungal biosynthesis gene clusters are silent under laboratory conditions, one of the major challenges is to understand the physiological role of these genes in the field (5, 6). Recently, we have shown that the intimate interaction of the fungus Aspergillus nidulans with a distinct soil-dwelling bacterium, i.e., Streptomyces hygroscopicus, led to activation of a so far silent polyketide biosynthesis gene cluster, indicating that communication between microorganisms might play a key role in activating silent gene clusters (18). It is also known that particular stress conditions, variations of culture conditions, and epigenetic modulation may induce significant changes in the metabolome (3, 17, 23). In most cases, however, the physiological conditions inducing such gene clusters are not understood, and it is often not possible to predict the complex regulatory circuits involved in pathway regulation (6, 16). Despite this limitation, combining genomic data, genetic engineering, and analytical techniques is a promising avenue to discover novel and potentially bioactive natural products (19). Nevertheless, more targeted approaches to induce selected biosynthetic pathways are desirable. Recently, we demonstrated that it is possible to activate a specific silent fungal gene cluster by the controlled expression of a gene coding for a pathway-specific transcription factor (2). Since various biosynthesis gene clusters contain such putative activator genes, we postulated that this is a generally applicable method for the activation of silent gene clusters.
Here we report another successful activation of a silent gene cluster using a potentially pathway-specific transcription factor. Strikingly, however, expression of this activator gene also led to the activation of yet another silent gene cluster located on a different chromosome. To the best of our knowledge, this is the first report showing regulatory cross talk between two different fungal biosynthesis gene clusters.
MATERIALS AND METHODS Strains and plasmids.The scpR overexpression strain SB3.5 (Table 1) was obtained by transformation of A. nidulans AXB4A2 with the expression vector pAL4 (22) containing scpR in fusion with the alcA promoter and the pyr-4 gene of Neurospora crassa (pAL4scpR) complementing pyrG mutants of A. nidulans to uracil prototrophy.
TABLE 1.Fungal strains used in this study
Strain Description Reference or source AXB4A2 pyrG89 pabaA1 fwA1 bga0 argB2::pAXB4A argB+ 22a AXB4A biA1 bga0 argB2::pAXB4A argB+ 3a TN02A7 pyrG89 pyroA4 nkuA::argB riboB2 20 SB3.5 pabaA1 fwA1 bga0 argB2::pAXB4A argB+pyrG89::pAL4scpR This study SB2.3 pyrG89 pyroA4 nkuA::argB riboB2::inpB riboB2 This study SB2.7 fwA1 pyrG89::pAL4scpR riboB2::inpB prototroph progeny This study Recovered from meiotic cross of strains SB3.5 and SB2.3 ALF1.1 fwA1 bga0 argB2::pAXB4A argB+pyrG89::pAL4scpR pabaA1::afoA This studyThe scpR gene was amplified by PCR from A. nidulans genomic DNA with the oligonucleotides 3492 XmaI for and 3492 XmaI rev (Table 2). Mutant strain SB2.3 with the inpB deletion was obtained by transformation of A. nidulans TN02A7 (14) using a linear DNA fragment that encoded 1-kb sequences homologous to the regions upstream and downstream of gene inpB (AN3496) flanking the riboB2 gene of A. nidulans as a selectable marker gene (20). DNA fragments encoding the upstream and downstream sequences of inpB were obtained by PCR with A. nidulans genomic DNA as the template and the oligonucleotide pairs 3496 up SspI for and 3496 up SspI rev and 3496 dwn XhoI for and 3496 dwn XhoI rev, respectively (Table 2).
TABLE 2.Oligonucleotides used in this study
Oligonucleotide Sequence (5′ → 3′) 3492 XmaI for CCCGGGGTATGAACACCATGAACAACATGCATCTC 3492 XmaI rev CCCGGGTCAATCAAACACCACCCCAGAAGCCGCG 3496 up SspI for AATATTCCTTGTTGAAGTGGTGTACAGGGG 3496 up SspI rev AATATTAATGATGGTGATGATGATGCTTGT 3496 dwn XhoI for CTCGAGGCTATGTTATACATCTCTGACACG 3496 dwn XhoI rev CTCGAGTTTTGCGTCCATTGATCGGACCCA 1029 up for GGAATCAGACCTTTAATTCCTCAGGCCGAG 1029 up rev TTTCTACAGATCTGGCAATGCCTCTGTCCGGACCGGAAAC pabaA1for TCCGGACACAGGCATTGCCAGATCTGTAGAAAGGTCTGC pabaA1rev GCCAGCTAATCAGTCTATCTGGACATGCGACGGAGATCG 1029 dwn for GTCGCATGTCCAGATAGACTGATTAGCTGGCCGATAGC 1029 dwn rev GCTTCAATTCCTCAACCTGGACCAGC 1029 ko for CAGGCCGAGTCGGGATCATTGAAG 1029 ko rev GTGACCGTGCAGATGGCCTGATAC 3490 for CCCCTCCAGTATGGGGCCCTGAGATGATGG 3490 rev CCCCGCCAGGCCGTCAAGTGTGCCAGGATC 3491 for GGAAAAGACTCAGACCCCGTCGCTCACGCC 3491 rev CACCAGCATAAAAGCGAGCATGATAACGCC 3492 for GAACACCATGAACAACATGCATCTCTACGC 3492 rev CCATCTGACTGGGCTCGCTCCAATCGGCC 3495 for GTCTCACTCAATGTCATCATCATCATCATC 3495 rev CCAACCCCCAGGCCGCATTGGCGATGGTCG 3496 for CCTGGCGCTATAGAATCCTCCCCATCGGAG 3496 rev GAGAGACCTGGACCAGCTGTAGTCGGTGTG 3497 for GAACGCCGTCGACAGTTTACTTGGAGTAGG 3497 rev CGGTAGCTTGAGCGCTTCCATACGTGCATG 1029 for CAGTTATTTTTTATTCTAACCCTGCTAG 1029 rev CTATGTACAATACCACCTCGTATCCTGTC 1036 for GTACAGCTGGCCTGACGATTCCATCCATCG 1036 rev GGGATGAACCCCTTCTCCATGGCCAGCACG 3492 for qRT-PCR GACGATGAACGAGATCGAGAC 3492 rev qRT-PCR GTGGATGGTGCAATATGCTAGG 3495 for qRT-PCR ACAATGCAGGACCACATCAG 3495 rev qRT-PCR GTCAATGAGAGGGCGAACAG 3496 for qRT-PCR TCAGTGGATCACACCAGGAG 3496 rev qRT-PCR CGAGACATCAACACCGAGAG 1029 for qRT-PCR ACGAGTGTTAAGCGAGCTG 1029 rev qRT-PCR CAATACCACCTCGTATCCTGTC 1034 for qRT-PCR GCAACCAGTTTACGCAAGTTC 1034 rev qRT-PCR GCTCTTCTCTTCGTCTTCGTC 1036 for qRT-PCR TTGAGAAGCCGAATCCGAAG 1036 rev qRT-PCR AAAGTTGTTCACGCTCGCC 6542 for qRT-PCR CACCCTTGTTCTTGTTTTGCTC 6542 rev qRT-PCR CAAGTTCGCTTTGGCAACGThe obtained recombinant plasmid was designated pKOinpB. A. nidulans strain SB2.7, encoding the deletion of inpB and the alcAp-scpR gene fusion in multiple copies ectopically integrated into the genome, was created by crossing strain SB3.5 with strain SB2.3. Plasmids were propagated in Escherichia coli DH5α (Invitrogen).
Mutant strain ALF1.1 with the afoA deletion was obtained by transformation of A. nidulans SB3.5 using a linear DNA fragment that encoded 1.3-kb sequences homologous to the regions upstream and downstream of gene afoA (AN1029) flanking the pabaA1 gene of A. nidulans as a selectable marker gene (see Fig. S1 in the supplemental material). This DNA fragment was created by fusion PCR of three precursor DNA fragments, namely, ko1029up, ko1029down, and the pabaA1 cassette amplified from A. nidulans DNA with primer pairs 1029 up for and 1029 up rev, 1029 dwn for and 1029 dwn rev, and pabaA1 for and pabaA1 rev, respectively. Fusion PCR was carried out with primers 1029 ko for and 1029 ko rev (Table 2).
Media and cultivation of strains.E. coli was grown at 37°C in LB medium supplemented with ampicillin (100 μg ml−1). A. nidulans strains were cultivated in Aspergillus minimal medium (AMM [4]). Required supplements were added as follows: uridine (1 mg ml−1), p-aminobenzoic acid (3 μg ml−1), or biotin (0.04 mg ml−1). As a preculture, a 50-ml AMM overnight culture inoculated with 5 × 106 conidia ml−1 was used. The biomass was separated from the medium using Miracloth material (Calbiochem), washed in 0.9% (wt vol−1) NaCl, and inoculated into 50 ml of fresh AMM. For growth under alcAp-repressing conditions, glucose (2%, wt vol−1) was used as the carbon source. For growth under alcAp-inducing conditions, lactose (2%, wt vol−1) was used as the carbon source and 10 mM cyclopentanone was added to the medium. After 24 h, samples were taken for Northern blot analysis, quantitative reverse transcription-PCR (qRT-PCR), transcriptome analysis, and high-pressure liquid chromatography (HPLC) analysis. For structure elucidation, a total of 8 liters fermentation broth divided into 250-ml portions in 1-liter flasks was incubated for 48 h under inducing conditions. Wild-type strain AXB4A was incubated in 250 ml AMM in a 1-liter flask as a control. Fungal cultures were homogenized and extracted with ethyl acetate.
Preparation of RNA, reverse transcription, labeling, ASMA, array hybridization, and data processing.The hybridization of the Aspergillus secondary metabolism array (ASMA) using cDNA of reverse-transcribed RNA from A. nidulans and the data processing were performed as described by Schroeckh et al. (18).
Northern blot analyses.Northern blot probes were labeled with digoxigenin-11-dUTP (DIG; Roche). The primers used for the amplification of the probes are listed in Table 2. TriSURE reagent (Bioline)-isolated total RNA samples from A. nidulans were separated on formaldehyde-containing agarose gels and blotted on Hybond-N+ positively charged nylon membranes (GE Healthcare). Hybridization was carried out in DIG-easy Hyb buffer, followed by binding of antidigoxigenin-alkaline phosphatase Fab fragments and application of CDP-Star ready-to-use solution (Roche). Thereby, fluorescence signals were generated and visualized on Super RX X-ray films (Fuji).
qRT-PCR.To quantify transcript levels by qRT-PCR, total RNA was purified and its quality was controlled as described previously (18). Ten micrograms of DNase I-treated RNA was utilized as a template for cDNA synthesis for 3 h at 48°C using Superscript III reverse transcriptase (Invitrogen). qRT-PCR was performed on an Applied Biosystems StepOnePlus real-time PCR system in triplicate for each sample. The A. nidulans β-actin gene AN6542 was used as an internal standard for calculation of expression levels. The cDNA samples were diluted 10 times for amplification to obtain EvaGreen reagent (Biotium)-labeled PCR fragments (GeneAmp Fast PCR master mix; Applied Biosystems) by using primers specific for scpR, inpA, inpB, afoA, afoE, afoG, and the β-actin gene (Table 2), resulting in amplicons of 83, 84, 86, 111, 101, 116, and 105 bp, respectively. The cycling parameters included an initial DNA denaturation step at 95°C for 2 min, followed by 40 cycles with DNA denaturation at 95°C for 10 s and primer annealing and extension at 62°C for 15 s. Controls with no added template were included for each primer pair to exclude primer dimers from interfering with amplification detection. qRT-PCR results were analyzed as described previously (18).
Preparation of chromosomal DNA and Southern blot analysis.Genomic DNA from A. nidulans mycelia was isolated using a MasterPure yeast DNA purification kit (Epicentre Biotechnologies), according to a modified isolation protocol (13). Cells were disrupted in a Precellys24 homogenizer (Peqlab) for 3 cycles (30 s grinding/30 s pause) at a rotation speed of 6,500 rpm in an Innuspeed lysis tube A (Analytik Jena). Southern blot analysis was carried out by using a nonradioactively labeled DNA probe as described for Northern blot analysis.
Extraction and isolation of compounds.NMR spectra were recorded on a Bruker Avance DRX 500 instrument. Spectra were referenced to the residual solvent signals. Analytical HPLC was performed on a Shimadzu HPLC system consisting of an autosampler, high-pressure pumps, a column oven, and a photodiode array detector (PDA), using a C18 column (250 by 4.6 mm; Eurospher 100-5) and gradient elution with acetonitrile (MeCN)-0.1% (vol/vol) trifluoroacetic acid (TFA) from (0.5/99.5 in 30 min to MeCN-0.1% (vol/vol) TFA at 100/0 and then 100% MeCN for 10 min, and the flow rate was 1 ml min−1. Preparative HPLC was performed using a Shimadzu HPLC system (LC-8A) with PDA and a C18 column (250 by 20 mm; Eurospher 100-5).
The entire fermentation broth was extracted with ethyl acetate, and the combined extracts were concentrated under reduced pressure. The crude extract was separated by size-exclusion chromatography on a Sephadex LH-20 column using methanol as an eluent. Metabolite-containing fractions were further purified by preparative HPLC (gradient mode with MeCN-H2O at 2% MeCN to 83% MeCN in 30 min and then with 83% MeCN for 10 min; flow rate, 10 ml min−1). Additional physicochemical data for asperfuranone are shown in Table S1 in the supplemental material.
Identification of putative binding site for C2H2 transcription factor AN3492.The whole intergenic regions of the genes inpA/inpB, inpC/inpD, and afoA/AN1030 were submitted to the MEME tool for motif prediction (1). Only one motif was found in all three sequences with a P value of 10−7. This motif was further submitted to the TOMTOM tool (10) (see Fig. S2 in the supplemental material) in the MEME suite of programs in order to find similarities to known transcription factor binding sites. The motif showed a significant similarity (P = 10−3) to the matrix for RME1, a yeast zinc-finger transcription factor with a C2H2 domain.
RESULTS Activation of silent inp gene cluster of A. nidulans by overexpression of its putative pathway-specific regulatory gene scpR.The secondary metabolite gene cluster inp (see Fig. 4A) of A. nidulans comprises two nonribosomal peptide synthetase (NRPS) genes, which were named as described by von Döhren (21): interacting NRPSs inpA (AN3495) and inpB (AN3496). The metabolic product of this gene cluster is unknown, and no related gene cluster can be found among the aspergilli (21). The product of the NRPSs InpA and InpB was proposed to be a tripeptide with a reduced C terminus (21). Since the NRPS genes are not transcribed under standard laboratory conditions (Fig. 1), we reasoned that this gene cluster is a typical silent gene cluster. The inp locus contains a putative activator gene, which we designated “secondary metabolism cross-pathway regulator” scpR (AN3492). Its deduced gene product resembles a typical C2H2-type zinc-finger transcription factor. For overexpression of this putative pathway-specific regulatory gene (scpR), we applied the inducible alcohol dehydrogenase promoter alcAp of A. nidulans (2). Transformation of A. nidulans strain AXB4A2 with the plasmid harboring the scpR gene under the control of alcAp resulted in several transformant strains that are chemically inducible. By Southern blot analysis, a transformant designated SB3.5 with multiple ectopic integrations of the alcAp-scpR gene fusion was identified (see Fig. S1A in the supplemental material). The transcription of the regulatory gene was unequivocally proven by Northern blot analysis (Fig. 1A). Under inducing conditions (with cyclopentanone), a significant amount of scpR mRNA was detected in strain SB3.5. This mRNA was absent under noninducing conditions, confirming that this gene is silent under standard laboratory conditions. As expected, the genes encoding both NRPS genes, inpA and inpB, were also transcribed under inducing conditions in strain SB3.5, indicating that the regulatory gene scpR controls the expression of these biosynthesis genes (Fig. 1A and B) and, moreover, that these two genes are also silent under standard laboratory conditions.
FIG. 1.Northern blot analysis. Total RNA (10 μg) from the A. nidulans wild-type and transformant strains was analyzed. All strains were incubated in AMM under alcAp-repressing (lanes R) and alcAp-inducing (lanes I) conditions. scpR (AN3492) blots were hybridized with an scpR full-length 834-bp DNA fragment obtained by PCR from A. nidulans chromosomal DNA with the oligonucleotides 3492 XmaI for and 3492 XmaI rev (Table 2). (A) A. nidulans wild-type (wt) strain AXB4A and strain SB3.5 alcAp-scpR. The 800-bp inpA (AN3495) probe was obtained by PCR from A. nidulans chromosomal DNA with the oligonucleotides 3495 for and 3495 rev (Table 2). (B) Strain SB3.5 alcAp-scpR. Probes of 800 bp for inpA (AN3495), inpB (AN3496), inpC (AN3490), inpD (AN3491), and AN3497 were obtained by PCR from A. nidulans chromosomal DNA with oligonucleotide pairs 3495 for and 3495 rev, 3496 for and 3496 rev, 3490 for and 3490 rev, 3491 for and 3491 rev, and 3497 for and 3497 rev, respectively (Table 2). (C) Strain SB3.5 alcAp-scpR and strain ALF1.1 alcAp-scpR carrying the afoA deletion. The probes for afoA (AN1029), afoG (AN1036), and inpB (AN3496) were obtained by PCR from A. nidulans chromosomal DNA with oligonucleotide pairs 1029 for and 1029 rev, 1036 for and 1036 rev, and 3496 for and 3496 rev, respectively (Table 2).
Asperfuranone is produced under alcAp-scpR-inducing conditions.The induced expression of the biosynthesis genes prompted us to monitor the metabolome of the transformant strain for new metabolites under inducing conditions. Comparison of the HPLC profiles of the extracts from the transformant strain SB3.5 under inducing conditions with the transformant strain under noninducing conditions revealed the formation of a new metabolite by the induced transformant (Fig. 2A). The compound was isolated from the extract of an upscaled culture (8 liters), and its structure was elucidated by one-dimensional and two-dimensional nuclear magnetic resonance (NMR) and mass spectrometry (MS) measurements. Compound 1 has a molecular formula of C19H24O5, as established by high-resolution electron spray ionization mass spectrometry analysis and 13C NMR analysis (Fig. 2B). The 1H NMR spectrum displayed four methyl, two methine, two methylene, and three olefinic proton signals as well as one aromatic proton (δ 9.04 ppm). H,H-correlated spectroscopy (H,H-COSY) and heteronuclear multiple bond correlation (HMBC) couplings established the side chain. The substitution pattern of the ring system was deduced from the HMBC correlations, as shown in Fig. 2C. The HMBC coupling of H-16 with C-14, which could be observed only when d6-acetone was used as the solvent, and the nuclear Overhauser effect (NOE) signal between H-16 and H-7 revealed the connectivity of both parts of the molecule. In the course of our studies, this very compound was described (7) and named asperfuranone (Fig. 2B).
FIG. 2.(A) HPLC profiles of extracts from A. nidulans chemically inducible transformant strains SB3.5 and SB2.7 producing a novel compound. The strains were incubated in AMM under alcAp-inducing (I) and -repressing (R) conditions (the repressing condition profile of strain SB2.7 is identical to the one for SB3.5 [data not shown]). (B) Structure of asperfuranone (8). (C) H,H-COSY and HMBC couplings.
Transcriptome analysis reveals activation of the physically unrelated silent asperfuranone gene cluster on chromosome VIII by overexpression of scpR.Asperfuranone is a polyketide metabolite and thus is clearly not the product of the predicted NRPS assembly line, thus pointing to an intriguing regulatory cross talk. To analyze which other genes are induced upon induction of the regulatory gene scpR, we employed ASMA, which contains probes representing predicted secondary metabolite genes of A. nidulans (18). mRNA of transformant strain SB3.5 was isolated after cultivation under inducing and repressing conditions and reverse transcribed to cDNA, and the cDNA was hybridized with ASMA. The expression profile monitored by ASMA confirmed that the gene cluster inp, which harbors the scpR gene, was induced in the overexpressing strain. Surprisingly, a putative silent polyketide biosynthesis gene cluster was also specifically induced (see Fig. 4B and Table S2 in the supplemental material). The genes afoA (AN1029), afoB (AN1031), afoC (AN1032), afoD (AN1033), afoE (AN1034), afoF (AN1035), and afoG (AN1036) are required for asperfuranone biosynthesis (8). The afo cluster is represented within ASMA by probes for the genes afoA (AN1029), afoD (AN1033), afoE (AN1034), and afoG (AN1036), all of which were upregulated under scpR-overexpressing conditions in comparison to the level of regulation under repressing conditions. Chiang et al. (8) suggested that the gene AN1030 is not part of the gene locus because a deletion mutant still produced asperfuranone. Here, we found that this gene was also induced in strain SB3.5, suggesting that it may also belong to the afo cluster. All of these genes were clearly upregulated when the transcription of the alcAp-scpR gene fusion was induced (Table 3). Quantitative RT-PCR further confirmed the specific induction of both gene clusters in strain SB3.5, i.e., cluster inp on chromosome II, including the scpR gene, and the afo gene cluster on chromosome VIII, as shown by analysis of the regulatory gene afoA (AN1029) and the two polyketide synthase (PKS)-encoding genes afoE (AN1034) and afoG (AN1036) (Fig. 3).
TABLE 3.Changes in gene expression
Gene Fold change in gene expression at 24 h SB3.5 SB2.7 AXB4A inpC 2.114 3.285 −1.191 scpR 1.064 1.278 1.099 inpA 4.825 9.963 −1.054 inpB 2.427 −1.092 −1.222 AN3497 1.567 −1.027 1.639 afoA 1.300 1.558 1.489 AN1030 3.859 4.969 −1.080 afoD 3.741 4.760 1.022 afoE 1.555 2.219 1.015 afoG 2.598 3.907 1.152 FIG. 3.Relative quantity of the mRNA steady-state level determined by qRT-PCR of scpR, inpA, inpB, afoA, afoE, and afoG in strains SB3.5, SB2.7, and AXB4A (wild type) under inducing and repressing conditions. Relative quantities are given as the log10 of −ΔΔCT, where CT is threshold cycle. Data obtained by cultivation of A. nidulans AXB4A under repressing conditions were set as equal to 1.
Induction of the asperfuranone gene cluster is mediated not by a product of the inp cluster but by the transcription factor scpR.Two alternative scenarios could explain the induction of the asperfuranone gene cluster by the expression of the scpR gene. First, it is conceivable that ScpR induces the NRPS-encoding genes inpA and inpB of the respective gene cluster and that the product of this biosynthesis pathway leads to induction of the asperfuranone biosynthesis gene cluster. Alternatively, ScpR might directly or indirectly control both biosynthesis gene clusters, even though these loci are located on two different chromosomes. To address these questions, the formation of the yet unknown peptide had to be blocked by deletion of the NRPS gene inpB (AN3496). For this purpose, the inpB gene was replaced by the riboB2 gene in the A. nidulans ΔKU70 strain TN02A7 (14). The deletion of inpB in the transformant strain obtained, strain SB2.3, was confirmed by Southern blot analysis (see Fig. S1B in the supplemental material). Strain SB2.3, which carries the deletion, was then crossed with strain SB3.5, which carries the inducible alcAp-scpR transcription factor fusion. The resulting progeny, carrying both the deletion of the inpB gene and, in addition, the inducible alcAp-scpR transcription factor fusion ectopically integrated in multiple copies into the genome, was named SB2.7 (see Fig. S1C and D in the supplemental material). Strain SB2.7 was cultivated under inducing and repressing conditions and analyzed for both expression of biosynthesis genes by ASMA and its metabolic profile in comparison to the wild type. The Southern blot analysis indicating the deletion of inpB (see Fig. S1B in the supplemental material) was confirmed by data obtained with ASMA (Table 3) and qRT-PCR (Fig. 3). qRT-PCR analyses revealed that the relative quantities of mRNA steady-state levels of genes of both clusters increased upon overexpression of the alcAp-scpR gene fusion (Fig. 3). The only difference between transformant strains SB3.5 and SB2.7 is that SB2.7 lacks inpB expression due to the gene deletion. Furthermore, the production of asperfuranone was clearly detectable in both strains (Fig. 2). These data clearly rule out involvement of an NRPS product in the regulation. Instead, they indicate that the ScpR transcription factor plays a dual role in also inducing another biosynthesis gene cluster. This is even more remarkable, as scpR is part of one cluster and the two clusters are located on different chromosomes; cluster inp is located on chromosome II, whereas the afo gene cluster is located on chromosome VIII.
Deletion of the asperfuranone activator afoA abolishes asperfuranone biosynthesis under alcAp-scpR-inducing conditions.To demonstrate that upon scpR overexpression the asperfuranone gene cluster is activated by AfoA, as previously shown (7), and not directly by ScpR, we deleted the regulatory gene afoA. A DNA fragment encoding the cassette for the p-aminobenzoate synthase from A. nidulans flanked by upstream and downstream sequences of afoA was created by fusion PCR (see Materials and Methods). Transformation of strain SB3.5 yielded the strain ALF1.1, which is unable to produce AfoA. Northern blot analyses showed that under inducing conditions scpR mRNA was formed in both strains SB3.5 and ALF1.1, but only strain SB3.5 was able to produce afoA mRNA (Fig. 1C). Consistently, HPLC analysis provided evidence that the strain with the afoA deletion did not produce asperfuranone anymore. Hence, the expression of the afo gene cluster as well as the biosynthesis of asperfuranone under alcAp-scpR inducing conditions was abolished after the deletion of the asperfuranone activator gene afoA. Therefore, we concluded that for activation of the asperfuranone biosynthesis gene cluster via ScpR, the afoA regulatory gene is required (Fig. 4).
FIG. 4.Model of cross talk between the A. nidulans secondary metabolite gene cluster inp and afo in A. nidulans (modified as described elsewhere [8]). Each arrow indicates the direction of transcription, the relative sizes of the open reading frames, and the intron distribution deduced from analysis of the nucleotide sequences. (A) inp gene cluster on chromosome II. Orange arrows, NRPS genes; black arrows, additional putative cluster genes; red arrow, regulator gene scpR; white arrows, genes not characterized here; inpC, putative AMP binding enzyme; inpD, major facilitator superfamily; inpE, proteasome a type and b type; inpF, serine hydrolase (FSH1). (B) afo (asperfuranone) gene cluster on chromosome VIII. Gray arrows, PKS genes; black arrows, additional cluster genes; blue arrow, regulatory gene afoA; white arrows, genes whose involvement in asperfuranone biosynthesis is unclear.
The promoters of genes of the inp cluster share a motif with the afoA promoter.Comparison of the intergenic regions of the genes inpA/inpB, inpC/inpD, and afoA/AN1030 revealed that all three sequences share one motif which is not present in other intergenic regions of the inp and afo gene clusters. This motif (CT/C/AAAAGGAT/AT/GG/CA) shows significant similarity to the binding site of RME1, a yeast zinc-finger transcription factor which also contains a C2H2 domain. These data strongly support the theory that ScpR binds only to the afoA promoter, leading to the transcription of the asperfuranone activator gene afoA, which then activates the other genes of the afo gene cluster (Fig. 4).
DISCUSSIONThe genome of A. nidulans harbors 53 putative secondary metabolite gene clusters, most of which are silent under standardized cultivation conditions in the laboratory. In this study, we have focused on a silent gene cluster (inp) comprising two NRPS genes and a regulator gene. Induction of transcription factor ScpR using the regulatable alcA promoter triggered the expression of the inp pathway genes. Surprisingly, instead of the predicted NRPS product, we detected a novel polyketide, asperfuranone, in the broth of the induced transformant. By transcriptome analyses we found that the asperfuranone biosynthesis genes were significantly upregulated. This is remarkable, given the fact that the requisite gene cluster itself harbors a pathway-specific transcription factor, whose function was demonstrated (8). We thus concluded that either ScpR or the NRPS product would interact with the regulation of the afo gene locus. Through deletion of one of the NRPS genes of the inp gene cluster, we could rule out that the predicted coproduct produced is responsible for activating the afo gene cluster. This finding is also supported by our notion that the addition of culture supernatant or whole-culture extract of the induced SB3.5 strain with the afoE promoter fused to a reporter gene did not trigger the expression of the reporter gene, whereas homologous overexpression of scpR did (data not shown). In this context, it should also be noted that although a small peak in the HPLC profile of the mutant with the NRPS gene deletion disappeared, the isolation of the product from the induced transformant was hampered, likely due to the minute amounts produced. Future studies will address the nature of this cryptic peptide metabolite.
Because the four genes which have been proven to be involved in emericellamide biosynthesis by functional analysis, i.e., easA, easB, easC, and easD, were also upregulated under scpR-overexpressing conditions, the implication is that they are also regulated by ScpR. However, because the expression of these genes in glucose mineral salt media was previously demonstrated (7), they clearly do not form a silent gene cluster. Thus, it remains to be shown whether the emericellamide biosynthesis is also affected by ScpR.
In conclusion, we could unequivocally show that ScpR regulates both the PKS-encoding afo gene cluster and the NRPS-encoding inp gene cluster. Notably, both clusters are silent under noninducing conditions and are even located on different chromosomes, i.e., chromosomes II and VIII. Deletion of the afoA regulatory gene abolished the possibility to induce the afo gene cluster by overexpression of the scpR gene. Therefore, we concluded that ScpR controls the afo gene clusters directly by binding to the promoter of the afoA gene. This finding was also supported by the notion that afoA as well as the genes belonging to the inp gene cluster encodes potential binding sites for ScpR.
By replacing the native promoter of afoA (AN1029) with an alcA-inducible promoter, it was shown previously that the entire asperfuranone gene cluster can be induced. However, when the second transcription factor present in the cluster (AN1028) was deleted, the pathway was still induced. These results indicate that induction of afoA alone is sufficient to turn on the whole asperfuranone biosynthetic pathway and that AN1028 is probably not involved in the regulation of the pathway (8).
To the best of our knowledge this is the first report of cross talk between gene clusters in fungi, yet the role of this unprecedented cross talk is enigmatic and remains to be elucidated. However, this unexpected level of complexity in the communication between gene clusters has important implications for future work in the field of fungal secondary metabolism. Not only is it important to consider a potential regulatory cross talk in genome-mining approaches but also one should be aware of this possibility when studying the functions of individual biosynthesis gene clusters.
Supplementary Material[Supplemental material]
AcknowledgmentsWe thank M. G. Schwinger for technical assistance in cultivation of microorganisms and A. Perner and F. Rhein for MS and NMR measurements, respectively.
Financial support by the BMBF and TMBWK and the Jena School for Microbial Communication (JSMC) is gratefully acknowledged.
Footnotes ▿Published ahead of print on 15 October 2010.
REFERENCESThis section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials[Supplemental material]
RetroSearch is an open source project built by @garambo | Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4