Showing content from http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/doxyhtml/classCDense__seg__Base.html below:
NCBI C++ ToolKit: CDense_seg_Base Class Reference
CDense_seg_Base (void) virtual ~CDense_seg_Base (void) DECLARE_INTERNAL_TYPE_INFO () bool IsSetDim (void) const dimensionality Check if a value has been assigned to Dim data member. More...
bool CanGetDim (void) const Check if it is safe to call GetDim method. More...
void ResetDim (void) Reset Dim data member. More...
void SetDefaultDim (void) Assign default value to Dim data member. More...
TDim GetDim (void) const Get the Dim member data. More...
void SetDim (TDim value) Assign a value to Dim data member. More...
TDim & SetDim (void) Assign a value to Dim data member. More...
bool IsSetNumseg (void) const number of segments here Check if a value has been assigned to Numseg data member. More...
bool CanGetNumseg (void) const Check if it is safe to call GetNumseg method. More...
void ResetNumseg (void) Reset Numseg data member. More...
TNumseg GetNumseg (void) const Get the Numseg member data. More...
void SetNumseg (TNumseg value) Assign a value to Numseg data member. More...
TNumseg & SetNumseg (void) Assign a value to Numseg data member. More...
bool IsSetIds (void) const sequences in order Check if a value has been assigned to Ids data member. More...
bool CanGetIds (void) const Check if it is safe to call GetIds method. More...
void ResetIds (void) Reset Ids data member. More...
const TIds & GetIds (void) const Get the Ids member data. More...
TIds & SetIds (void) Assign a value to Ids data member. More...
bool IsSetStarts (void) const start OFFSETS in ids order within segs Check if a value has been assigned to Starts data member. More...
bool CanGetStarts (void) const Check if it is safe to call GetStarts method. More...
void ResetStarts (void) Reset Starts data member. More...
const TStarts & GetStarts (void) const Get the Starts member data. More...
TStarts & SetStarts (void) Assign a value to Starts data member. More...
bool IsSetLens (void) const lengths in ids order within segs Check if a value has been assigned to Lens data member. More...
bool CanGetLens (void) const Check if it is safe to call GetLens method. More...
void ResetLens (void) Reset Lens data member. More...
const TLens & GetLens (void) const Get the Lens member data. More...
TLens & SetLens (void) Assign a value to Lens data member. More...
bool IsSetStrands (void) const Check if a value has been assigned to Strands data member. More...
bool CanGetStrands (void) const Check if it is safe to call GetStrands method. More...
void ResetStrands (void) Reset Strands data member. More...
const TStrands & GetStrands (void) const Get the Strands member data. More...
TStrands & SetStrands (void) Assign a value to Strands data member. More...
bool IsSetScores (void) const score for each seg Check if a value has been assigned to Scores data member. More...
bool CanGetScores (void) const Check if it is safe to call GetScores method. More...
void ResetScores (void) Reset Scores data member. More...
const TScores & GetScores (void) const Get the Scores member data. More...
TScores & SetScores (void) Assign a value to Scores data member. More...
virtual void Reset (void) Reset the whole object. More...
CSerialObject (void) virtual ~CSerialObject (void) virtual const CTypeInfo * GetThisTypeInfo (void) const =0 virtual void Assign (const CSerialObject &source, ESerialRecursionMode how=eRecursive) Set object to copy of another one. More...
virtual bool Equals (const CSerialObject &object, ESerialRecursionMode how=eRecursive) const Check if both objects contain the same values. More...
virtual void DebugDump (CDebugDumpContext ddc, unsigned int depth) const Define method for dumping debug information. More...
void ThrowUnassigned (TMemberIndex index) const void ThrowUnassigned (TMemberIndex index, const char *file_name, int file_line) const bool HasNamespaceName (void) const Check if object data type has namespace name. More...
const string & GetNamespaceName (void) const Get namespace name. More...
bool HasNamespacePrefix (void) const Check if data type has namespace prefix. More...
const string & GetNamespacePrefix (void) const Get namespace prefix. More...
CObject (void) Constructor. More...
CObject (const CObject &src) Copy constructor. More...
virtual ~CObject (void) Destructor. More...
CObject & operator= (const CObject &src) THROWS_NONE Assignment operator. More...
bool CanBeDeleted (void) const THROWS_NONE Check if object can be deleted. More...
bool IsAllocatedInPool (void) const THROWS_NONE Check if object is allocated in memory pool (not system heap) More...
bool Referenced (void) const THROWS_NONE Check if object is referenced. More...
bool ReferencedOnlyOnce (void) const THROWS_NONE Check if object is referenced only once. More...
void AddReference (void) const Add reference to object. More...
void RemoveReference (void) const Remove reference to object. More...
void ReleaseReference (void) const Remove reference without deleting object. More...
virtual void DoNotDeleteThisObject (void) Mark this object as not allocated in heap – do not delete this object. More...
virtual void DoDeleteThisObject (void) Mark this object as allocated in heap – object can be deleted. More...
void * operator new (size_t size) Define new operator for memory allocation. More...
void * operator new[] (size_t size) Define new[] operator for 'array' memory allocation. More...
void operator delete (void *ptr) Define delete operator for memory deallocation. More...
void operator delete[] (void *ptr) Define delete[] operator for memory deallocation. More...
void * operator new (size_t size, void *place) Define new operator. More...
void operator delete (void *ptr, void *place) Define delete operator. More...
void * operator new (size_t size, CObjectMemoryPool *place) Define new operator using memory pool. More...
void operator delete (void *ptr, CObjectMemoryPool *place) Define delete operator. More...
CDebugDumpable (void) virtual ~CDebugDumpable (void) void DebugDumpText (ostream &out, const string &bundle, unsigned int depth) const void DebugDumpFormat (CDebugDumpFormatter &ddf, const string &bundle, unsigned int depth) const void DumpToConsole (void) const
Dense-seg: the densist packing for sequence alignments only.
a start of -1 indicates a gap for that sequence of length lens.
id=100 AAGGCCTTTTAGAGATGATGATGATGATGA id=200 AAGGCCTTTTAG.......GATGATGATGA id=300 ....CCTTTTAGAGATGATGAT....ATGA
dim = 3, numseg = 6, ids = { 100, 200, 300 } starts = { 0,0,-1, 4,4,0, 12,-1,8, 19,12,15, 22,15,-1, 26,19,18 } lens = { 4, 8, 7, 3, 4, 4 }
for (multiway) global or partial alignments
CDense_seg_Base –
Definition at line 91 of file Dense_seg_.hpp.
RetroSearch is an open source project built by @garambo
| Open a GitHub Issue
Search and Browse the WWW like it's 1997 | Search results from DuckDuckGo
HTML:
3.2
| Encoding:
UTF-8
| Version:
0.7.4